Incidental Mutation 'R0382:Fstl3'
Institutional Source Beutler Lab
Gene Symbol Fstl3
Ensembl Gene ENSMUSG00000020325
Gene Namefollistatin-like 3
SynonymsFlrg, E030038F23Rik
MMRRC Submission 038588-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0382 (G1)
Quality Score116
Status Validated
Chromosomal Location79777272-79782630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79777307 bp
Amino Acid Change Serine to Proline at position 3 (S3P)
Ref Sequence ENSEMBL: ENSMUSP00000020575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020573] [ENSMUST00000020575] [ENSMUST00000169684]
Predicted Effect probably benign
Transcript: ENSMUST00000020573
SMART Domains Protein: ENSMUSP00000020573
Gene: ENSMUSG00000020323

signal peptide 1 37 N/A INTRINSIC
Tryp_SPc 39 264 1.53e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020575
AA Change: S3P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020575
Gene: ENSMUSG00000020325
AA Change: S3P

signal peptide 1 23 N/A INTRINSIC
FOLN 96 118 4.13e-6 SMART
KAZAL 116 165 1.69e-11 SMART
FOLN 168 191 1.09e-5 SMART
KAZAL 197 241 1.02e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168798
Predicted Effect probably benign
Transcript: ENSMUST00000169684
SMART Domains Protein: ENSMUSP00000132215
Gene: ENSMUSG00000020323

signal peptide 1 37 N/A INTRINSIC
Tryp_SPc 39 264 1.53e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170380
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Follistatin-like 3 is a secreted glycoprotein of the follistatin-module-protein family. It may have a role in leukemogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Adult mice homozygous for a knock-out allele display increased pancreatic islet number and size, beta cell hyperplasia, hepatic steatosis, increased heart weight, mild hypertension, and alterations in glucose homeostasis and fat distribution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 A T 6: 86,946,919 Q266L probably benign Het
Abca13 T C 11: 9,636,650 probably benign Het
Adap2 T C 11: 80,178,385 probably benign Het
Adgrb2 C G 4: 130,007,831 P416R probably damaging Het
Brinp1 T C 4: 68,762,308 R662G possibly damaging Het
Celsr3 C A 9: 108,829,218 P967T probably damaging Het
Ces1b T C 8: 93,076,052 probably benign Het
Ckm T C 7: 19,421,384 *382Q probably null Het
Clec14a A G 12: 58,268,617 V73A probably damaging Het
Cmya5 A T 13: 93,092,748 V1944E probably benign Het
Col6a6 T A 9: 105,755,555 D1473V probably damaging Het
Cttnbp2 A G 6: 18,435,343 M172T probably benign Het
Dcaf12 T C 4: 41,302,672 N161S probably damaging Het
Dnah17 T C 11: 118,128,996 Y75C probably damaging Het
Efcab7 T C 4: 99,901,769 V388A possibly damaging Het
Fat3 A G 9: 15,959,756 C3780R probably damaging Het
Fbxl14 T C 6: 119,481,060 *401R probably null Het
Fbxo5 G T 10: 5,801,176 Y270* probably null Het
Fnbp1l A T 3: 122,570,953 probably benign Het
Gpatch1 T C 7: 35,301,655 D309G probably damaging Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Klk6 A G 7: 43,829,245 D192G probably benign Het
Lrp6 A G 6: 134,467,668 S1080P probably damaging Het
Lztfl1 T C 9: 123,707,906 probably null Het
Mov10l1 A G 15: 88,985,593 Y59C possibly damaging Het
Natd1 C T 11: 60,906,913 R62H probably damaging Het
Obscn T C 11: 59,040,306 T5835A probably damaging Het
Olfr1052 A G 2: 86,298,593 Y259C probably damaging Het
Olfr1183 A T 2: 88,461,725 R147S possibly damaging Het
Olfr1354 T A 10: 78,917,126 Y95* probably null Het
Olfr792 T C 10: 129,541,014 I159T probably benign Het
P2rx2 T A 5: 110,341,179 E289V probably benign Het
Patl1 T A 19: 11,925,232 probably null Het
Ptprf A G 4: 118,223,394 probably benign Het
Qrfpr C T 3: 36,180,969 C253Y possibly damaging Het
Rad21l A T 2: 151,645,443 D540E probably damaging Het
Rbm45 T A 2: 76,370,211 I28N possibly damaging Het
Rnf170 A T 8: 26,125,899 probably benign Het
Sgsm3 G A 15: 81,008,314 W280* probably null Het
Slc9a9 A T 9: 94,685,217 H113L probably benign Het
Slc9b2 G T 3: 135,318,422 C78F probably damaging Het
Slfn10-ps T A 11: 83,029,534 noncoding transcript Het
Slfn8 T A 11: 83,004,556 I475F probably damaging Het
Stox2 A G 8: 47,203,284 probably benign Het
Strbp A T 2: 37,600,826 N472K probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tmem39a A G 16: 38,591,398 probably benign Het
Trpc4ap A G 2: 155,636,230 L664P probably damaging Het
Uap1 T A 1: 170,161,482 M124L probably benign Het
Usp48 A G 4: 137,621,218 N536S probably benign Het
Usp50 T A 2: 126,777,928 I155F probably damaging Het
Utp4 T C 8: 106,922,935 I672T probably benign Het
Vmn1r94 A T 7: 20,167,653 M242K possibly damaging Het
Vmn2r45 T G 7: 8,483,099 N397H probably benign Het
Vmn2r9 T C 5: 108,847,597 Y395C probably damaging Het
Vps41 C A 13: 18,827,727 H335N probably benign Het
Other mutations in Fstl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02680:Fstl3 APN 10 79778672 nonsense probably null
IGL03165:Fstl3 APN 10 79779965 missense probably benign 0.02
R2113:Fstl3 UTSW 10 79781178 missense probably damaging 0.96
R2964:Fstl3 UTSW 10 79781223 missense probably benign
R2965:Fstl3 UTSW 10 79781223 missense probably benign
R2966:Fstl3 UTSW 10 79781223 missense probably benign
R5211:Fstl3 UTSW 10 79780178 missense probably benign 0.01
R6225:Fstl3 UTSW 10 79780009 missense probably benign 0.08
R7389:Fstl3 UTSW 10 79780031 missense probably damaging 1.00
R7390:Fstl3 UTSW 10 79780031 missense probably damaging 1.00
R7484:Fstl3 UTSW 10 79780031 missense probably damaging 1.00
T0722:Fstl3 UTSW 10 79780163 missense probably damaging 1.00
X0003:Fstl3 UTSW 10 79780163 missense probably damaging 1.00
X0022:Fstl3 UTSW 10 79780067 missense probably benign 0.06
Z1176:Fstl3 UTSW 10 79781198 missense probably benign
Z1177:Fstl3 UTSW 10 79780108 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gggaggaaaaagtacccacaag -3'
Posted On2013-08-08