Incidental Mutation 'R8451:Samd4'
ID654777
Institutional Source Beutler Lab
Gene Symbol Samd4
Ensembl Gene ENSMUSG00000021838
Gene Namesterile alpha motif domain containing 4
Synonyms4933436G17Rik, 1700024G08Rik, Smaug, 1700111L17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001037221, NM_028966, NM_001163433

Is this an essential gene? Probably essential (E-score: 0.842) question?
Stock #R8451 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location46882854-47105815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47101431 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 703 (D703G)
Ref Sequence ENSEMBL: ENSMUSP00000022386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022386] [ENSMUST00000100672] [ENSMUST00000125113] [ENSMUST00000125688] [ENSMUST00000137543] [ENSMUST00000228404]
Predicted Effect probably damaging
Transcript: ENSMUST00000022386
AA Change: D703G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022386
Gene: ENSMUSG00000021838
AA Change: D703G

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
low complexity region 292 305 N/A INTRINSIC
SAM 320 383 1.4e-7 SMART
low complexity region 445 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100672
AA Change: D615G

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000098237
Gene: ENSMUSG00000021838
AA Change: D615G

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
SAM 232 295 2.75e-6 SMART
low complexity region 357 375 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125113
AA Change: D602G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122833
Gene: ENSMUSG00000021838
AA Change: D602G

DomainStartEndE-ValueType
low complexity region 191 204 N/A INTRINSIC
SAM 219 282 1.4e-7 SMART
low complexity region 344 362 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125688
AA Change: D294G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115569
Gene: ENSMUSG00000021838
AA Change: D294G

DomainStartEndE-ValueType
low complexity region 36 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137543
AA Change: D615G

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000114621
Gene: ENSMUSG00000021838
AA Change: D615G

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
SAM 232 295 2.75e-6 SMART
low complexity region 357 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227848
Predicted Effect probably benign
Transcript: ENSMUST00000228404
AA Change: D514G

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sterile alpha motifs (SAMs) in proteins such as SAMD4A are part of an RNA-binding domain that functions as a posttranscriptional regulator by binding to an RNA sequence motif known as the Smaug recognition element, which was named after the Drosophila Smaug protein (Baez and Boccaccio, 2005 [PubMed 16221671]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit leaness, myopathy and altered glucose metabolism. Mice homozygous for a spontaneous mutation exhibit kyphosis, abnormal gait, and decreased cortical bone thickness. [provided by MGI curators]
Allele List at MGI

ll alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik G A 5: 138,562,926 T158M probably benign Het
9130204L05Rik A T 3: 91,088,364 M77K probably benign Het
Acss3 T C 10: 107,049,404 H242R probably damaging Het
Ago2 G T 15: 73,130,890 D164E probably damaging Het
Arl2bp G A 8: 94,666,879 E6K unknown Het
Bola1 G A 3: 96,197,257 A7V probably benign Het
Ccdc18 A G 5: 108,155,797 E249G probably damaging Het
Cep162 G A 9: 87,192,850 Q1360* probably null Het
Cep350 T C 1: 155,872,034 I2047V probably damaging Het
Cntnap5c C T 17: 58,055,692 R347W probably damaging Het
Fmo6 C T 1: 162,920,605 V297M probably damaging Het
Furin C T 7: 80,398,722 V17M probably benign Het
Gm8994 T A 6: 136,328,544 M1K probably null Het
Hs6st1 A G 1: 36,069,060 T135A probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Klk1 A G 7: 44,228,986 E190G probably benign Het
Map3k21 T C 8: 125,944,733 L920P probably benign Het
Mecom T A 3: 29,985,370 H180L probably benign Het
Mras T C 9: 99,411,495 I31V probably damaging Het
Nrxn3 A G 12: 89,510,643 D532G probably damaging Het
Nufip2 A G 11: 77,692,355 N365S probably damaging Het
Olfr1317 A T 2: 112,142,061 M39L probably benign Het
Olfr1416 T C 1: 92,479,938 I228V probably benign Het
Olfr527 T C 7: 140,336,605 Y248H probably damaging Het
Pgbd1 A T 13: 21,423,380 S215T probably benign Het
Ptcd3 A G 6: 71,908,641 C34R probably benign Het
Scaper A T 9: 55,816,804 N623K possibly damaging Het
Slc12a9 C A 5: 137,315,475 V741L probably benign Het
Slc12a9 T C 5: 137,328,448 D249G probably benign Het
Slc3a1 A G 17: 85,028,496 N22S possibly damaging Het
Sugct A G 13: 17,252,558 L339P probably damaging Het
Tenm3 T C 8: 48,287,872 D1192G probably damaging Het
Tinagl1 T A 4: 130,167,583 D289V probably damaging Het
Tnrc6b C A 15: 80,923,490 P1548T probably damaging Het
Trmt1l A G 1: 151,448,288 K152E unknown Het
Vmn1r173 T A 7: 23,702,532 L64* probably null Het
Zcchc2 T A 1: 106,030,932 N1044K probably damaging Het
Zfp750 T C 11: 121,513,309 I247V probably benign Het
Other mutations in Samd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Samd4 APN 14 47052898 missense probably damaging 1.00
IGL01413:Samd4 APN 14 47016792 missense probably benign 0.01
supermodel UTSW 14 47016337 missense probably damaging 1.00
B6584:Samd4 UTSW 14 47016337 missense probably damaging 1.00
G1Funyon:Samd4 UTSW 14 47016678 missense probably benign
G4846:Samd4 UTSW 14 47016319 missense probably damaging 1.00
R0096:Samd4 UTSW 14 47064297 missense possibly damaging 0.88
R0122:Samd4 UTSW 14 47016560 missense probably benign 0.44
R0562:Samd4 UTSW 14 47077509 missense probably damaging 1.00
R1247:Samd4 UTSW 14 47064328 critical splice donor site probably benign
R1247:Samd4 UTSW 14 47087758 small insertion probably benign
R1771:Samd4 UTSW 14 47089075 missense probably damaging 1.00
R1902:Samd4 UTSW 14 47074128 missense probably damaging 1.00
R1903:Samd4 UTSW 14 47074128 missense probably damaging 1.00
R2346:Samd4 UTSW 14 46884842 missense probably damaging 1.00
R4155:Samd4 UTSW 14 47052946 missense possibly damaging 0.74
R4498:Samd4 UTSW 14 47096109 missense probably damaging 1.00
R4510:Samd4 UTSW 14 47077585 missense probably benign 0.05
R4511:Samd4 UTSW 14 47077585 missense probably benign 0.05
R4658:Samd4 UTSW 14 47064246 missense probably damaging 1.00
R4871:Samd4 UTSW 14 47066463 missense probably damaging 1.00
R4991:Samd4 UTSW 14 47074010 missense probably damaging 0.97
R5432:Samd4 UTSW 14 47074062 missense probably benign 0.09
R5687:Samd4 UTSW 14 47016565 missense probably benign
R6035:Samd4 UTSW 14 47087872 missense probably damaging 1.00
R6035:Samd4 UTSW 14 47087872 missense probably damaging 1.00
R6254:Samd4 UTSW 14 47016631 missense probably damaging 1.00
R6366:Samd4 UTSW 14 47074150 critical splice donor site probably null
R6376:Samd4 UTSW 14 47052962 missense probably damaging 1.00
R6944:Samd4 UTSW 14 47016635 missense possibly damaging 0.94
R7035:Samd4 UTSW 14 47089163 synonymous silent
R7148:Samd4 UTSW 14 47016683 missense probably benign 0.09
R7467:Samd4 UTSW 14 47087856 missense probably benign 0.19
R7999:Samd4 UTSW 14 47064247 missense probably damaging 0.99
R8301:Samd4 UTSW 14 47016678 missense probably benign
R8306:Samd4 UTSW 14 46884917 missense probably damaging 1.00
R8351:Samd4 UTSW 14 47101431 missense probably damaging 1.00
X0018:Samd4 UTSW 14 47016696 missense possibly damaging 0.94
X0022:Samd4 UTSW 14 47074017 missense probably benign 0.45
Z0001:Samd4 UTSW 14 47016337 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTCCAGATGTTAGATGGGTG -3'
(R):5'- GCTCTCACAAAATCAAAATGGGCG -3'

Sequencing Primer
(F):5'- CCAGATGTTAGATGGGTGATAATGTC -3'
(R):5'- TCAAAATGGGCGAGGGACC -3'
Posted On2020-10-20