Mutagenetix > Incidental Mutation

Incidental Mutation 'R8453:Mmrn1'

654848

Institutional Source

Beutler Lab

Gene Symbol

Mmrn1

Ensembl Gene

ENSMUSG00000054641

Gene Name

multimerin 1

Synonyms

4921530G03Rik, Emilin4

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8453 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60924976-60989378 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 60988377 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1131 (Y1131N)

Ref Sequence

ENSEMBL: ENSMUSP00000119609 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000129603
AA Change: Y1131N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: Y1131N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	3.3e-12	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1026	1059	1.62e-5	SMART
C1Q	1076	1210	6.74e-49	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000204333
AA Change: Y1130N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: Y1130N

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	7.7e-13	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1025	1058	1.62e-5	SMART
C1Q	1075	1209	6.74e-49	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	A	T	5: 90,566,501	R123S	possibly damaging	Het
8030462N17Rik	T	C	18: 77,673,908	E236G	probably damaging	Het
9630041A04Rik	G	T	9: 101,938,685	C23F	possibly damaging	Het
Adam29	T	C	8: 55,873,161	H86R	possibly damaging	Het
Alas1	C	T	9: 106,236,522	R508Q	possibly damaging	Het
Bmp3	G	A	5: 98,855,423		probably null	Het
Bud13	A	G	9: 46,288,201	T287A	probably benign	Het
C3	T	C	17: 57,212,643	E1203G	probably benign	Het
Carmil2	A	C	8: 105,690,211	Q476P	probably damaging	Het
Ccdc187	T	A	2: 26,276,446	T707S	probably damaging	Het
Cfap43	A	T	19: 47,746,647	V1435E	probably damaging	Het
Chrm3	A	T	13: 9,877,231	*590K	probably null	Het
Commd1	C	T	11: 22,978,503		probably benign	Het
Creb3l1	A	T	2: 91,990,929	Y314*	probably null	Het
Ctc1	T	A	11: 69,022,449	S90R	probably benign	Het
Dixdc1	T	C	9: 50,684,886	Q413R	probably benign	Het
Dlg5	T	C	14: 24,158,145	T998A	probably benign	Het
Fam89b	A	G	19: 5,728,875	S99P	possibly damaging	Het
Fbxo30	A	G	10: 11,290,735	I400M	probably benign	Het
Gad1	A	T	2: 70,600,713	M567L	probably benign	Het
Gemin5	T	C	11: 58,125,239	S1314G	probably benign	Het
Gm2035	C	T	12: 87,919,553	S102N	probably benign	Het
Gm9195	T	G	14: 72,440,761	I2323L	probably benign	Het
Gria1	T	A	11: 57,243,051	F585L	probably damaging	Het
Hbs1l	A	T	10: 21,309,279	H200L	probably benign	Het
Igsf5	A	G	16: 96,421,796	Q360R	probably benign	Het
Il31ra	A	T	13: 112,524,183	V624E	probably damaging	Het
Iqsec3	T	C	6: 121,387,820	R837G	probably damaging	Het
Lpl	A	G	8: 68,895,781	I221V	probably damaging	Het
Mcf2l	T	C	8: 12,984,956		probably null	Het
Mink1	T	A	11: 70,610,328	D887E	possibly damaging	Het
Mmp10	T	G	9: 7,508,202	F443C	probably damaging	Het
Mrc2	T	A	11: 105,332,311	V460E	probably damaging	Het
Nicn1	T	A	9: 108,293,373	F57Y	probably damaging	Het
Nlrp4b	A	G	7: 10,715,601	Y577C	probably damaging	Het
Nrap	T	C	19: 56,323,920	T1535A	probably damaging	Het
Opa1	G	A	16: 29,620,868	R755H	probably damaging	Het
P4htm	C	T	9: 108,580,367		probably benign	Het
Phldb2	A	G	16: 45,825,022	S354P	probably benign	Het
Phykpl	T	C	11: 51,598,294	S316P	probably damaging	Het
Pnpla1	T	A	17: 28,858,899	D11E	probably benign	Het
Pold2	A	G	11: 5,875,104	F98L	probably damaging	Het
Prph	G	A	15: 99,056,776	R241Q	probably benign	Het
Rcl1	T	C	19: 29,115,759	I58T	possibly damaging	Het
Rps6ka2	A	G	17: 7,246,752	N117D	probably benign	Het
Sars	G	A	3: 108,428,713	S331L	probably benign	Het
Scfd1	A	C	12: 51,412,591	K312Q	possibly damaging	Het
Senp5	A	G	16: 31,989,348	C363R	probably benign	Het
Senp7	A	G	16: 56,188,328	I1024V	probably damaging	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Sptbn4	A	G	7: 27,404,238	L1191P	probably damaging	Het
Ssfa2	T	C	2: 79,644,785	S363P	probably benign	Het
Stk40	A	G	4: 126,128,973	E180G	probably damaging	Het
Stxbp5	A	T	10: 9,809,048	V536E	probably benign	Het
Suco	A	T	1: 161,823,017		probably benign	Het
Tex15	G	T	8: 33,576,871	E2110*	probably null	Het
Thbs4	G	A	13: 92,790,817	P55S	probably benign	Het
Tmem115	T	C	9: 107,534,798	V107A	probably benign	Het
Tnfaip6	A	C	2: 52,055,867	I242L	probably benign	Het
Trabd	G	T	15: 89,085,413	A270S	possibly damaging	Het
Trim30d	T	A	7: 104,487,740	I86F	probably damaging	Het
Trpc7	A	G	13: 56,822,559	V404A	probably benign	Het
Vmn1r61	A	G	7: 5,610,887	Y143H	probably benign	Het
Vmn2r18	T	A	5: 151,561,908	D707V	probably damaging	Het
Vnn3	G	A	10: 23,869,545	R464H	probably benign	Het
Wdr27	T	C	17: 14,892,489	T652A	probably benign	Het
Wdr78	A	G	4: 103,059,916	I577T	possibly damaging	Het
Yeats2	C	T	16: 20,222,887	R1176*	probably null	Het

Other mutations in Mmrn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Mmrn1	APN	6	60977513	missense	probably benign
IGL00742:Mmrn1	APN	6	60958120	missense	probably damaging	1.00
IGL00917:Mmrn1	APN	6	60975910	nonsense	probably null
IGL01121:Mmrn1	APN	6	60975944	missense	possibly damaging	0.46
IGL01393:Mmrn1	APN	6	60960708	splice site	probably benign
IGL01697:Mmrn1	APN	6	60976493	missense	possibly damaging	0.46
IGL01737:Mmrn1	APN	6	60977161	missense	probably benign
IGL01944:Mmrn1	APN	6	60971183	critical splice donor site	probably null
IGL01987:Mmrn1	APN	6	60944573	missense	probably benign	0.31
IGL02005:Mmrn1	APN	6	60960744	missense	probably damaging	1.00
IGL02190:Mmrn1	APN	6	60987193	missense	probably benign	0.13
IGL02335:Mmrn1	APN	6	60977147	missense	possibly damaging	0.79
IGL02421:Mmrn1	APN	6	60944822	missense	probably benign	0.00
IGL02530:Mmrn1	APN	6	60958176	missense	possibly damaging	0.73
IGL02709:Mmrn1	APN	6	60973046	missense	probably damaging	1.00
IGL03139:Mmrn1	APN	6	60976340	missense	probably damaging	0.99
IGL03228:Mmrn1	APN	6	60944892	missense	probably benign	0.02
IGL03272:Mmrn1	APN	6	60988435	missense	probably damaging	1.00
IGL03410:Mmrn1	APN	6	60975835	missense	probably benign	0.36
H8562:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
K2124:Mmrn1	UTSW	6	60976033	missense	possibly damaging	0.87
R0145:Mmrn1	UTSW	6	60973010	missense	probably damaging	1.00
R0164:Mmrn1	UTSW	6	60975815	splice site	probably benign
R0352:Mmrn1	UTSW	6	60944971	missense	probably benign	0.03
R0400:Mmrn1	UTSW	6	60977115	missense	probably benign	0.00
R0538:Mmrn1	UTSW	6	60976469	missense	probably benign	0.00
R0907:Mmrn1	UTSW	6	60973119	missense	probably benign	0.09
R1117:Mmrn1	UTSW	6	60976325	missense	possibly damaging	0.51
R1383:Mmrn1	UTSW	6	60976322	missense	probably damaging	1.00
R1542:Mmrn1	UTSW	6	60945118	missense	probably damaging	0.98
R1591:Mmrn1	UTSW	6	60944771	nonsense	probably null
R1599:Mmrn1	UTSW	6	60945037	missense	probably benign
R1733:Mmrn1	UTSW	6	60977101	missense	probably benign	0.00
R2005:Mmrn1	UTSW	6	60976084	missense	possibly damaging	0.88
R2056:Mmrn1	UTSW	6	60944805	missense	probably benign	0.00
R2144:Mmrn1	UTSW	6	60945075	missense	possibly damaging	0.54
R2299:Mmrn1	UTSW	6	60976441	missense	probably damaging	0.99
R3836:Mmrn1	UTSW	6	60944847	missense	probably benign
R3837:Mmrn1	UTSW	6	60944847	missense	probably benign
R4206:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
R4414:Mmrn1	UTSW	6	60944586	missense	probably damaging	1.00
R4590:Mmrn1	UTSW	6	60960813	missense	probably damaging	1.00
R4707:Mmrn1	UTSW	6	60988473	missense	probably benign	0.12
R4820:Mmrn1	UTSW	6	60973043	missense	probably benign	0.04
R4880:Mmrn1	UTSW	6	60976439	missense	probably benign	0.15
R5166:Mmrn1	UTSW	6	60976490	missense	probably benign	0.04
R5324:Mmrn1	UTSW	6	60976586	missense	probably damaging	1.00
R5887:Mmrn1	UTSW	6	60987074	missense	probably benign
R5917:Mmrn1	UTSW	6	60973150	critical splice donor site	probably null
R6108:Mmrn1	UTSW	6	60975976	missense	possibly damaging	0.83
R6539:Mmrn1	UTSW	6	60987184	missense	probably benign	0.01
R6996:Mmrn1	UTSW	6	60977383	missense	probably benign	0.04
R7064:Mmrn1	UTSW	6	60988540	nonsense	probably null
R7073:Mmrn1	UTSW	6	60988427	missense	probably damaging	1.00
R7213:Mmrn1	UTSW	6	60944543	start gained	probably benign
R7256:Mmrn1	UTSW	6	60976114	missense	probably damaging	0.98
R7324:Mmrn1	UTSW	6	60944933	nonsense	probably null
R7350:Mmrn1	UTSW	6	60976336	nonsense	probably null
R7388:Mmrn1	UTSW	6	60976252	missense	probably benign	0.43
R7652:Mmrn1	UTSW	6	60977506	missense	probably benign	0.14
R7664:Mmrn1	UTSW	6	60976705	missense	probably benign	0.44
R7810:Mmrn1	UTSW	6	60976325	missense	probably benign	0.18
R7832:Mmrn1	UTSW	6	60987060	splice site	probably null
R7979:Mmrn1	UTSW	6	60975977	missense	probably damaging	0.96
R8071:Mmrn1	UTSW	6	60944524	start gained	probably benign
R8130:Mmrn1	UTSW	6	60960723	missense	probably damaging	1.00
R8277:Mmrn1	UTSW	6	60977236	missense	probably benign	0.19
R8353:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8472:Mmrn1	UTSW	6	60988396	missense	probably damaging	1.00
R8758:Mmrn1	UTSW	6	60987209	missense	possibly damaging	0.54
R8803:Mmrn1	UTSW	6	60988287	missense	probably damaging	1.00
R8879:Mmrn1	UTSW	6	60976529	missense	probably damaging	0.99
R8907:Mmrn1	UTSW	6	60976093	missense	probably damaging	1.00
R8983:Mmrn1	UTSW	6	60976058	missense	probably benign	0.04
R9200:Mmrn1	UTSW	6	60976876	missense	probably damaging	1.00
R9287:Mmrn1	UTSW	6	60975955	missense	probably damaging	1.00
R9387:Mmrn1	UTSW	6	60958192	nonsense	probably null
R9612:Mmrn1	UTSW	6	60976424	missense	probably damaging	0.96
R9674:Mmrn1	UTSW	6	60971088	nonsense	probably null
X0026:Mmrn1	UTSW	6	60976013	missense	probably benign	0.09
Z1176:Mmrn1	UTSW	6	60945034	missense	probably benign	0.37
Z1177:Mmrn1	UTSW	6	60987098	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- CAAAGGATCTTACAGATATGCTCCG -3'
(R):5'- CTCACACAAACTTAGGTGCG -3'

Sequencing Primer
(F):5'- ACAGATATGCTCCGATGGTGGC -3'
(R):5'- CACTGAACGTGGTCACAGG -3'

Posted On

2020-10-20