Mutagenetix > Incidental Mutation

Incidental Mutation 'R8453:Sptbn4'

654852

Institutional Source

Beutler Lab

Gene Symbol

Sptbn4

Ensembl Gene

ENSMUSG00000011751

Gene Name

spectrin beta, non-erythrocytic 4

Synonyms

ROSA62, 1700022P15Rik, dyn, neuroaxonal dystrophy, 5830426A08Rik, nmf261, SpbIV, Spnb4

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.442) question?

Stock #

R8453 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

27356383-27447686 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 27404238 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1191 (L1191P)

Ref Sequence

ENSEMBL: ENSMUSP00000011895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000172269]

AlphaFold

E9PX29

Predicted Effect

probably damaging
Transcript: ENSMUST00000011895
AA Change: L1191P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: L1191P

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.4e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	642	7.62e-19	SMART
SPEC	648	766	1.31e-8	SMART
SPEC	772	874	2.94e-11	SMART
SPEC	880	980	1.49e-21	SMART
SPEC	986	1081	1.65e0	SMART
SPEC	1087	1192	2.82e-13	SMART
SPEC	1198	1298	6.59e-14	SMART
SPEC	1304	1403	4.08e-19	SMART
SPEC	1409	1508	5.92e-7	SMART
SPEC	1514	1614	2.45e-22	SMART
SPEC	1620	1720	1.45e-24	SMART
SPEC	1726	1827	1.86e-22	SMART
SPEC	1833	1935	9.54e-11	SMART
SPEC	1941	2041	1.35e-19	SMART
SPEC	2047	2297	1.06e-8	SMART
low complexity region	2358	2412	N/A	INTRINSIC
PH	2416	2526	1.54e-14	SMART
low complexity region	2549	2560	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172269
AA Change: L1186P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: L1186P

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.9e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	637	3.45e-17	SMART
SPEC	643	761	1.31e-8	SMART
SPEC	767	869	2.94e-11	SMART
SPEC	875	975	1.49e-21	SMART
SPEC	981	1076	1.65e0	SMART
SPEC	1082	1187	2.82e-13	SMART
SPEC	1193	1293	6.59e-14	SMART
SPEC	1299	1398	4.08e-19	SMART
SPEC	1404	1503	5.92e-7	SMART
SPEC	1509	1609	2.45e-22	SMART
SPEC	1615	1715	1.45e-24	SMART
SPEC	1721	1822	1.86e-22	SMART
SPEC	1828	1930	9.54e-11	SMART
SPEC	1936	2036	1.35e-19	SMART
SPEC	2042	2292	1.06e-8	SMART
low complexity region	2352	2406	N/A	INTRINSIC
PH	2410	2520	1.54e-14	SMART
low complexity region	2543	2554	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	A	T	5: 90,566,501	R123S	possibly damaging	Het
8030462N17Rik	T	C	18: 77,673,908	E236G	probably damaging	Het
9630041A04Rik	G	T	9: 101,938,685	C23F	possibly damaging	Het
Adam29	T	C	8: 55,873,161	H86R	possibly damaging	Het
Alas1	C	T	9: 106,236,522	R508Q	possibly damaging	Het
Bmp3	G	A	5: 98,855,423		probably null	Het
Bud13	A	G	9: 46,288,201	T287A	probably benign	Het
C3	T	C	17: 57,212,643	E1203G	probably benign	Het
Carmil2	A	C	8: 105,690,211	Q476P	probably damaging	Het
Ccdc187	T	A	2: 26,276,446	T707S	probably damaging	Het
Cfap43	A	T	19: 47,746,647	V1435E	probably damaging	Het
Chrm3	A	T	13: 9,877,231	*590K	probably null	Het
Commd1	C	T	11: 22,978,503		probably benign	Het
Creb3l1	A	T	2: 91,990,929	Y314*	probably null	Het
Ctc1	T	A	11: 69,022,449	S90R	probably benign	Het
Dixdc1	T	C	9: 50,684,886	Q413R	probably benign	Het
Dlg5	T	C	14: 24,158,145	T998A	probably benign	Het
Fam89b	A	G	19: 5,728,875	S99P	possibly damaging	Het
Fbxo30	A	G	10: 11,290,735	I400M	probably benign	Het
Gad1	A	T	2: 70,600,713	M567L	probably benign	Het
Gemin5	T	C	11: 58,125,239	S1314G	probably benign	Het
Gm2035	C	T	12: 87,919,553	S102N	probably benign	Het
Gm9195	T	G	14: 72,440,761	I2323L	probably benign	Het
Gria1	T	A	11: 57,243,051	F585L	probably damaging	Het
Hbs1l	A	T	10: 21,309,279	H200L	probably benign	Het
Igsf5	A	G	16: 96,421,796	Q360R	probably benign	Het
Il31ra	A	T	13: 112,524,183	V624E	probably damaging	Het
Iqsec3	T	C	6: 121,387,820	R837G	probably damaging	Het
Lpl	A	G	8: 68,895,781	I221V	probably damaging	Het
Mcf2l	T	C	8: 12,984,956		probably null	Het
Mink1	T	A	11: 70,610,328	D887E	possibly damaging	Het
Mmp10	T	G	9: 7,508,202	F443C	probably damaging	Het
Mmrn1	T	A	6: 60,988,377	Y1131N	probably damaging	Het
Mrc2	T	A	11: 105,332,311	V460E	probably damaging	Het
Nicn1	T	A	9: 108,293,373	F57Y	probably damaging	Het
Nlrp4b	A	G	7: 10,715,601	Y577C	probably damaging	Het
Nrap	T	C	19: 56,323,920	T1535A	probably damaging	Het
Opa1	G	A	16: 29,620,868	R755H	probably damaging	Het
P4htm	C	T	9: 108,580,367		probably benign	Het
Phldb2	A	G	16: 45,825,022	S354P	probably benign	Het
Phykpl	T	C	11: 51,598,294	S316P	probably damaging	Het
Pnpla1	T	A	17: 28,858,899	D11E	probably benign	Het
Pold2	A	G	11: 5,875,104	F98L	probably damaging	Het
Prph	G	A	15: 99,056,776	R241Q	probably benign	Het
Rcl1	T	C	19: 29,115,759	I58T	possibly damaging	Het
Rps6ka2	A	G	17: 7,246,752	N117D	probably benign	Het
Sars	G	A	3: 108,428,713	S331L	probably benign	Het
Scfd1	A	C	12: 51,412,591	K312Q	possibly damaging	Het
Senp5	A	G	16: 31,989,348	C363R	probably benign	Het
Senp7	A	G	16: 56,188,328	I1024V	probably damaging	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Ssfa2	T	C	2: 79,644,785	S363P	probably benign	Het
Stk40	A	G	4: 126,128,973	E180G	probably damaging	Het
Stxbp5	A	T	10: 9,809,048	V536E	probably benign	Het
Suco	A	T	1: 161,823,017		probably benign	Het
Tex15	G	T	8: 33,576,871	E2110*	probably null	Het
Thbs4	G	A	13: 92,790,817	P55S	probably benign	Het
Tmem115	T	C	9: 107,534,798	V107A	probably benign	Het
Tnfaip6	A	C	2: 52,055,867	I242L	probably benign	Het
Trabd	G	T	15: 89,085,413	A270S	possibly damaging	Het
Trim30d	T	A	7: 104,487,740	I86F	probably damaging	Het
Trpc7	A	G	13: 56,822,559	V404A	probably benign	Het
Vmn1r61	A	G	7: 5,610,887	Y143H	probably benign	Het
Vmn2r18	T	A	5: 151,561,908	D707V	probably damaging	Het
Vnn3	G	A	10: 23,869,545	R464H	probably benign	Het
Wdr27	T	C	17: 14,892,489	T652A	probably benign	Het
Wdr78	A	G	4: 103,059,916	I577T	possibly damaging	Het
Yeats2	C	T	16: 20,222,887	R1176*	probably null	Het

Other mutations in Sptbn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sptbn4	APN	7	27369434	missense	probably damaging	1.00
IGL00468:Sptbn4	APN	7	27417965	missense	probably damaging	1.00
IGL01396:Sptbn4	APN	7	27414771	missense	probably benign	0.06
IGL01700:Sptbn4	APN	7	27404268	missense	probably damaging	1.00
IGL01878:Sptbn4	APN	7	27364146	missense	probably damaging	0.99
IGL02066:Sptbn4	APN	7	27364515	missense	possibly damaging	0.68
IGL02116:Sptbn4	APN	7	27364357	missense	probably benign
IGL02226:Sptbn4	APN	7	27365707	missense	probably damaging	1.00
IGL02333:Sptbn4	APN	7	27364299	missense	probably damaging	1.00
IGL02337:Sptbn4	APN	7	27428247	missense	probably benign	0.03
IGL02451:Sptbn4	APN	7	27365589	missense	probably null	0.15
IGL02487:Sptbn4	APN	7	27419097	missense	probably damaging	1.00
IGL02530:Sptbn4	APN	7	27391551	missense	probably damaging	1.00
IGL02724:Sptbn4	APN	7	27367679	missense	probably damaging	1.00
IGL02850:Sptbn4	APN	7	27426833	missense	possibly damaging	0.95
IGL02851:Sptbn4	APN	7	27426833	missense	possibly damaging	0.95
IGL02869:Sptbn4	APN	7	27394148	splice site	probably benign
IGL02961:Sptbn4	APN	7	27397967	missense	probably damaging	1.00
ANU22:Sptbn4	UTSW	7	27357387	nonsense	probably null
R0194:Sptbn4	UTSW	7	27404911	missense	probably benign	0.00
R0328:Sptbn4	UTSW	7	27364170	missense	probably damaging	1.00
R0379:Sptbn4	UTSW	7	27359736	splice site	probably benign
R0510:Sptbn4	UTSW	7	27361566	critical splice donor site	probably null
R0550:Sptbn4	UTSW	7	27364378	missense	probably benign	0.16
R0557:Sptbn4	UTSW	7	27408328	nonsense	probably null
R1336:Sptbn4	UTSW	7	27417963	missense	probably damaging	1.00
R1494:Sptbn4	UTSW	7	27434294	missense	probably damaging	1.00
R1630:Sptbn4	UTSW	7	27418739	missense	probably benign	0.09
R1803:Sptbn4	UTSW	7	27418583	missense	probably damaging	1.00
R1834:Sptbn4	UTSW	7	27366646	missense	probably null	0.96
R1906:Sptbn4	UTSW	7	27391431	critical splice donor site	probably null
R1924:Sptbn4	UTSW	7	27407138	missense	probably damaging	1.00
R1951:Sptbn4	UTSW	7	27366443	missense	possibly damaging	0.64
R1989:Sptbn4	UTSW	7	27367702	missense	probably damaging	1.00
R1990:Sptbn4	UTSW	7	27423810	missense	probably benign	0.19
R2005:Sptbn4	UTSW	7	27366419	nonsense	probably null
R2083:Sptbn4	UTSW	7	27428256	missense	probably benign	0.29
R2176:Sptbn4	UTSW	7	27364162	missense	probably benign	0.21
R2211:Sptbn4	UTSW	7	27367609	missense	probably damaging	1.00
R2262:Sptbn4	UTSW	7	27434357	missense	probably damaging	1.00
R2263:Sptbn4	UTSW	7	27434357	missense	probably damaging	1.00
R2374:Sptbn4	UTSW	7	27360092	missense	probably damaging	0.99
R2407:Sptbn4	UTSW	7	27418098	nonsense	probably null
R4115:Sptbn4	UTSW	7	27391570	missense	probably damaging	1.00
R4116:Sptbn4	UTSW	7	27391570	missense	probably damaging	1.00
R4392:Sptbn4	UTSW	7	27418471	missense	probably damaging	0.97
R4426:Sptbn4	UTSW	7	27423798	missense	probably damaging	1.00
R4535:Sptbn4	UTSW	7	27367702	missense	probably damaging	1.00
R4684:Sptbn4	UTSW	7	27364419	missense	probably damaging	0.96
R4684:Sptbn4	UTSW	7	27366735	missense	possibly damaging	0.60
R4707:Sptbn4	UTSW	7	27417006	missense	probably benign	0.12
R4876:Sptbn4	UTSW	7	27372152	missense	probably damaging	1.00
R5091:Sptbn4	UTSW	7	27369391	missense	probably damaging	1.00
R5371:Sptbn4	UTSW	7	27359741	critical splice donor site	probably null
R5790:Sptbn4	UTSW	7	27366428	missense	probably damaging	0.99
R5857:Sptbn4	UTSW	7	27418713	missense	possibly damaging	0.89
R5908:Sptbn4	UTSW	7	27404253	missense	probably benign	0.00
R5980:Sptbn4	UTSW	7	27372171	missense	probably damaging	1.00
R6005:Sptbn4	UTSW	7	27418599	missense	probably damaging	1.00
R6013:Sptbn4	UTSW	7	27364479	missense	probably damaging	0.99
R6037:Sptbn4	UTSW	7	27364170	missense	probably damaging	0.97
R6037:Sptbn4	UTSW	7	27364170	missense	probably damaging	0.97
R6129:Sptbn4	UTSW	7	27360088	missense	probably damaging	0.98
R6146:Sptbn4	UTSW	7	27364587	nonsense	probably null
R6762:Sptbn4	UTSW	7	27394208	missense	probably damaging	1.00
R6897:Sptbn4	UTSW	7	27371950	missense	possibly damaging	0.96
R7178:Sptbn4	UTSW	7	27418056	missense	probably damaging	1.00
R7212:Sptbn4	UTSW	7	27416785	missense	probably benign	0.44
R7465:Sptbn4	UTSW	7	27366689	missense	probably benign	0.00
R7471:Sptbn4	UTSW	7	27409014	missense	possibly damaging	0.64
R7510:Sptbn4	UTSW	7	27428268	missense	probably benign	0.13
R7527:Sptbn4	UTSW	7	27375590	missense	possibly damaging	0.94
R7528:Sptbn4	UTSW	7	27442535	missense	probably benign	0.00
R7572:Sptbn4	UTSW	7	27372272	missense	probably damaging	0.99
R7649:Sptbn4	UTSW	7	27361577	missense	possibly damaging	0.80
R7714:Sptbn4	UTSW	7	27364336	missense	probably benign	0.02
R7780:Sptbn4	UTSW	7	27361634	missense	possibly damaging	0.70
R7854:Sptbn4	UTSW	7	27362410	missense	probably benign
R8002:Sptbn4	UTSW	7	27417992	missense	possibly damaging	0.91
R8058:Sptbn4	UTSW	7	27364269	missense	possibly damaging	0.92
R8181:Sptbn4	UTSW	7	27375383	missense	possibly damaging	0.79
R8195:Sptbn4	UTSW	7	27408889	nonsense	probably null
R8353:Sptbn4	UTSW	7	27404238	missense	probably damaging	1.00
R8392:Sptbn4	UTSW	7	27372296	missense	probably damaging	1.00
R8815:Sptbn4	UTSW	7	27407232	nonsense	probably null
R8818:Sptbn4	UTSW	7	27364167	missense	possibly damaging	0.71
R9171:Sptbn4	UTSW	7	27442419	missense	possibly damaging	0.95
R9259:Sptbn4	UTSW	7	27367699	missense	possibly damaging	0.74
R9477:Sptbn4	UTSW	7	27433199	missense	possibly damaging	0.79
R9564:Sptbn4	UTSW	7	27418079	missense	probably damaging	0.98
R9572:Sptbn4	UTSW	7	27366670	missense	probably benign	0.16
R9623:Sptbn4	UTSW	7	27408382	missense	probably damaging	1.00
R9715:Sptbn4	UTSW	7	27391575	missense	probably damaging	1.00
R9782:Sptbn4	UTSW	7	27408568	missense	probably benign	0.02
R9790:Sptbn4	UTSW	7	27372237	missense	probably damaging	0.99
R9791:Sptbn4	UTSW	7	27372237	missense	probably damaging	0.99
R9798:Sptbn4	UTSW	7	27357292	makesense	probably null
X0020:Sptbn4	UTSW	7	27402734	critical splice donor site	probably null
X0066:Sptbn4	UTSW	7	27357311	unclassified	probably benign
Z1176:Sptbn4	UTSW	7	27360025	missense	probably damaging	0.99
Z1177:Sptbn4	UTSW	7	27404582	missense	probably damaging	1.00
Z1177:Sptbn4	UTSW	7	27409102	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- ATCTAGGGGTCCCAGGAAAC -3'
(R):5'- GATACTTTCCTGGACTGGCTGG -3'

Sequencing Primer
(F):5'- TAGGGGTCCCAGGAAACACATC -3'
(R):5'- CGCTCAAGGAGGAGGTGGATC -3'

Posted On

2020-10-20