Mutagenetix > Incidental Mutation

Incidental Mutation 'R8453:Mcf2l'

654856

Institutional Source

Beutler Lab

Gene Symbol

Mcf2l

Ensembl Gene

ENSMUSG00000031442

Gene Name

mcf.2 transforming sequence-like

Synonyms

C130040G20Rik, Dbs

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8453 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12873806-13020905 bp(+) (GRCm38)

Type of Mutation

splice site (6 bp from exon)

DNA Base Change (assembly)

T to C at 12984956 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000133776 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095456] [ENSMUST00000098927] [ENSMUST00000110866] [ENSMUST00000110867] [ENSMUST00000110871] [ENSMUST00000110873] [ENSMUST00000110876] [ENSMUST00000110879] [ENSMUST00000145067] [ENSMUST00000173006] [ENSMUST00000173099]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000095456

SMART Domains

Protein: ENSMUSP00000093108
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SEC14	75	221	1.77e-24	SMART
SPEC	354	455	4.41e-15	SMART
coiled coil region	507	529	N/A	INTRINSIC
low complexity region	578	594	N/A	INTRINSIC
RhoGEF	636	811	2.83e-63	SMART
PH	831	948	8.13e-14	SMART
low complexity region	966	978	N/A	INTRINSIC
SH3	1058	1115	3.33e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000098927

SMART Domains

Protein: ENSMUSP00000096528
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SEC14	49	195	1.77e-24	SMART
SPEC	328	429	4.41e-15	SMART
coiled coil region	481	503	N/A	INTRINSIC
low complexity region	552	568	N/A	INTRINSIC
RhoGEF	610	785	2.83e-63	SMART
PH	805	922	8.13e-14	SMART
low complexity region	940	952	N/A	INTRINSIC
low complexity region	1022	1033	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110866

SMART Domains

Protein: ENSMUSP00000106490
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SEC14	23	169	1.77e-24	SMART
SPEC	302	403	4.41e-15	SMART
coiled coil region	455	477	N/A	INTRINSIC
low complexity region	526	542	N/A	INTRINSIC
RhoGEF	584	759	2.83e-63	SMART
PH	779	896	8.13e-14	SMART
low complexity region	914	926	N/A	INTRINSIC
SH3	1006	1063	3.33e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000110867

SMART Domains

Protein: ENSMUSP00000106491
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SEC14	23	169	1.77e-24	SMART
SPEC	302	403	4.41e-15	SMART
coiled coil region	455	477	N/A	INTRINSIC
low complexity region	526	542	N/A	INTRINSIC
RhoGEF	584	759	2.83e-63	SMART
PH	779	896	8.13e-14	SMART
low complexity region	914	926	N/A	INTRINSIC
SH3	1006	1063	3.33e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000110871

SMART Domains

Protein: ENSMUSP00000106495
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
SEC14	43	189	1.77e-24	SMART
SPEC	322	423	4.41e-15	SMART
coiled coil region	475	497	N/A	INTRINSIC
low complexity region	546	562	N/A	INTRINSIC
RhoGEF	604	779	2.83e-63	SMART
PH	799	916	8.13e-14	SMART
low complexity region	934	946	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110873

SMART Domains

Protein: ENSMUSP00000106497
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SPEC	165	266	4.41e-15	SMART
coiled coil region	318	340	N/A	INTRINSIC
low complexity region	389	405	N/A	INTRINSIC
RhoGEF	447	622	2.83e-63	SMART
PH	642	759	8.13e-14	SMART
low complexity region	777	789	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110876

SMART Domains

Protein: ENSMUSP00000106500
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SEC14	45	191	1.77e-24	SMART
SPEC	324	425	4.41e-15	SMART
coiled coil region	477	499	N/A	INTRINSIC
low complexity region	548	564	N/A	INTRINSIC
RhoGEF	606	781	2.83e-63	SMART
PH	801	918	8.13e-14	SMART
low complexity region	936	948	N/A	INTRINSIC
SH3	1084	1141	3.33e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000110879

SMART Domains

Protein: ENSMUSP00000106503
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SEC14	45	191	1.77e-24	SMART
SPEC	324	425	4.41e-15	SMART
coiled coil region	477	499	N/A	INTRINSIC
low complexity region	548	564	N/A	INTRINSIC
RhoGEF	606	781	2.83e-63	SMART
PH	801	918	8.13e-14	SMART
low complexity region	936	948	N/A	INTRINSIC
SH3	1028	1085	3.33e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000145067

SMART Domains

Protein: ENSMUSP00000133577
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
Pfam:CRAL_TRIO_2	16	132	2.4e-12	PFAM
SPEC	261	362	4.41e-15	SMART
coiled coil region	414	436	N/A	INTRINSIC
low complexity region	485	501	N/A	INTRINSIC
RhoGEF	543	718	2.83e-63	SMART
PH	738	855	8.13e-14	SMART
low complexity region	873	885	N/A	INTRINSIC
SH3	1021	1078	3.33e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000173006

SMART Domains

Protein: ENSMUSP00000134147
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
Pfam:CRAL_TRIO_2	1	104	1.3e-12	PFAM
SPEC	233	334	4.41e-15	SMART
coiled coil region	386	408	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
RhoGEF	515	690	2.83e-63	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000173099

SMART Domains

Protein: ENSMUSP00000133776
Gene: ENSMUSG00000031442

Domain	Start	End	E-Value	Type
SEC14	41	187	1.77e-24	SMART
SPEC	320	421	4.41e-15	SMART
coiled coil region	473	495	N/A	INTRINSIC
low complexity region	544	560	N/A	INTRINSIC
RhoGEF	602	777	2.83e-63	SMART
PH	797	914	8.13e-14	SMART
low complexity region	932	944	N/A	INTRINSIC
low complexity region	1014	1025	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor that interacts specifically with the GTP-bound Rac1 and plays a role in the Rho/Rac signaling pathways. A variant in this gene was associated with osteoarthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830473C10Rik	A	T	5: 90,566,501	R123S	possibly damaging	Het
8030462N17Rik	T	C	18: 77,673,908	E236G	probably damaging	Het
9630041A04Rik	G	T	9: 101,938,685	C23F	possibly damaging	Het
Adam29	T	C	8: 55,873,161	H86R	possibly damaging	Het
Alas1	C	T	9: 106,236,522	R508Q	possibly damaging	Het
Bmp3	G	A	5: 98,855,423		probably null	Het
Bud13	A	G	9: 46,288,201	T287A	probably benign	Het
C3	T	C	17: 57,212,643	E1203G	probably benign	Het
Carmil2	A	C	8: 105,690,211	Q476P	probably damaging	Het
Ccdc187	T	A	2: 26,276,446	T707S	probably damaging	Het
Cfap43	A	T	19: 47,746,647	V1435E	probably damaging	Het
Chrm3	A	T	13: 9,877,231	*590K	probably null	Het
Commd1	C	T	11: 22,978,503		probably benign	Het
Creb3l1	A	T	2: 91,990,929	Y314*	probably null	Het
Ctc1	T	A	11: 69,022,449	S90R	probably benign	Het
Dixdc1	T	C	9: 50,684,886	Q413R	probably benign	Het
Dlg5	T	C	14: 24,158,145	T998A	probably benign	Het
Fam89b	A	G	19: 5,728,875	S99P	possibly damaging	Het
Fbxo30	A	G	10: 11,290,735	I400M	probably benign	Het
Gad1	A	T	2: 70,600,713	M567L	probably benign	Het
Gemin5	T	C	11: 58,125,239	S1314G	probably benign	Het
Gm2035	C	T	12: 87,919,553	S102N	probably benign	Het
Gm9195	T	G	14: 72,440,761	I2323L	probably benign	Het
Gria1	T	A	11: 57,243,051	F585L	probably damaging	Het
Hbs1l	A	T	10: 21,309,279	H200L	probably benign	Het
Igsf5	A	G	16: 96,421,796	Q360R	probably benign	Het
Il31ra	A	T	13: 112,524,183	V624E	probably damaging	Het
Iqsec3	T	C	6: 121,387,820	R837G	probably damaging	Het
Lpl	A	G	8: 68,895,781	I221V	probably damaging	Het
Mink1	T	A	11: 70,610,328	D887E	possibly damaging	Het
Mmp10	T	G	9: 7,508,202	F443C	probably damaging	Het
Mmrn1	T	A	6: 60,988,377	Y1131N	probably damaging	Het
Mrc2	T	A	11: 105,332,311	V460E	probably damaging	Het
Nicn1	T	A	9: 108,293,373	F57Y	probably damaging	Het
Nlrp4b	A	G	7: 10,715,601	Y577C	probably damaging	Het
Nrap	T	C	19: 56,323,920	T1535A	probably damaging	Het
Opa1	G	A	16: 29,620,868	R755H	probably damaging	Het
P4htm	C	T	9: 108,580,367		probably benign	Het
Phldb2	A	G	16: 45,825,022	S354P	probably benign	Het
Phykpl	T	C	11: 51,598,294	S316P	probably damaging	Het
Pnpla1	T	A	17: 28,858,899	D11E	probably benign	Het
Pold2	A	G	11: 5,875,104	F98L	probably damaging	Het
Prph	G	A	15: 99,056,776	R241Q	probably benign	Het
Rcl1	T	C	19: 29,115,759	I58T	possibly damaging	Het
Rps6ka2	A	G	17: 7,246,752	N117D	probably benign	Het
Sars	G	A	3: 108,428,713	S331L	probably benign	Het
Scfd1	A	C	12: 51,412,591	K312Q	possibly damaging	Het
Senp5	A	G	16: 31,989,348	C363R	probably benign	Het
Senp7	A	G	16: 56,188,328	I1024V	probably damaging	Het
Sh2b1	TGGGGACCAGCTCAGCCACGGGGACCAGCTC	TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC	7: 126,467,570		probably benign	Het
Sptbn4	A	G	7: 27,404,238	L1191P	probably damaging	Het
Ssfa2	T	C	2: 79,644,785	S363P	probably benign	Het
Stk40	A	G	4: 126,128,973	E180G	probably damaging	Het
Stxbp5	A	T	10: 9,809,048	V536E	probably benign	Het
Suco	A	T	1: 161,823,017		probably benign	Het
Tex15	G	T	8: 33,576,871	E2110*	probably null	Het
Thbs4	G	A	13: 92,790,817	P55S	probably benign	Het
Tmem115	T	C	9: 107,534,798	V107A	probably benign	Het
Tnfaip6	A	C	2: 52,055,867	I242L	probably benign	Het
Trabd	G	T	15: 89,085,413	A270S	possibly damaging	Het
Trim30d	T	A	7: 104,487,740	I86F	probably damaging	Het
Trpc7	A	G	13: 56,822,559	V404A	probably benign	Het
Vmn1r61	A	G	7: 5,610,887	Y143H	probably benign	Het
Vmn2r18	T	A	5: 151,561,908	D707V	probably damaging	Het
Vnn3	G	A	10: 23,869,545	R464H	probably benign	Het
Wdr27	T	C	17: 14,892,489	T652A	probably benign	Het
Wdr78	A	G	4: 103,059,916	I577T	possibly damaging	Het
Yeats2	C	T	16: 20,222,887	R1176*	probably null	Het

Other mutations in Mcf2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Mcf2l	APN	8	13000857	missense	probably damaging	0.98
IGL00426:Mcf2l	APN	8	12984910	missense	probably damaging	1.00
IGL01391:Mcf2l	APN	8	13014010	splice site	probably null
IGL01795:Mcf2l	APN	8	13000749	splice site	probably null
IGL02314:Mcf2l	APN	8	13001851	missense	probably damaging	0.99
IGL02716:Mcf2l	APN	8	12997277	missense	probably benign	0.19
IGL02985:Mcf2l	APN	8	12963239	missense	probably damaging	1.00
IGL03073:Mcf2l	APN	8	13000004	missense	probably damaging	1.00
IGL03308:Mcf2l	APN	8	13009512	missense	probably damaging	1.00
IGL03371:Mcf2l	APN	8	13001298	missense	probably damaging	1.00
P0022:Mcf2l	UTSW	8	13018897	nonsense	probably null
R0062:Mcf2l	UTSW	8	13006766	unclassified	probably benign
R0067:Mcf2l	UTSW	8	13013060	missense	probably benign	0.01
R0110:Mcf2l	UTSW	8	12997337	missense	probably damaging	1.00
R0450:Mcf2l	UTSW	8	12997337	missense	probably damaging	1.00
R0469:Mcf2l	UTSW	8	12997337	missense	probably damaging	1.00
R0510:Mcf2l	UTSW	8	12997337	missense	probably damaging	1.00
R0543:Mcf2l	UTSW	8	12996728	critical splice donor site	probably null
R0591:Mcf2l	UTSW	8	13018751	missense	probably benign	0.11
R0801:Mcf2l	UTSW	8	13014020	intron	probably benign
R0962:Mcf2l	UTSW	8	13001964	missense	probably benign	0.14
R1084:Mcf2l	UTSW	8	13002645	missense	possibly damaging	0.94
R1794:Mcf2l	UTSW	8	12915982	missense	probably benign	0.33
R2111:Mcf2l	UTSW	8	13001867	missense	probably damaging	0.99
R2112:Mcf2l	UTSW	8	13001867	missense	probably damaging	0.99
R3785:Mcf2l	UTSW	8	12880099	missense	probably damaging	0.97
R4777:Mcf2l	UTSW	8	13018051	splice site	probably null
R4858:Mcf2l	UTSW	8	13013972	missense	probably damaging	1.00
R4980:Mcf2l	UTSW	8	12984883	missense	probably damaging	1.00
R5021:Mcf2l	UTSW	8	13011808	missense	probably damaging	1.00
R5067:Mcf2l	UTSW	8	12915959	intron	probably benign
R5158:Mcf2l	UTSW	8	13009715	missense	probably damaging	1.00
R5439:Mcf2l	UTSW	8	12926646	missense	possibly damaging	0.85
R5569:Mcf2l	UTSW	8	13005481	missense	probably damaging	1.00
R5655:Mcf2l	UTSW	8	13010444	missense	probably damaging	0.98
R5668:Mcf2l	UTSW	8	13013812	nonsense	probably null
R5753:Mcf2l	UTSW	8	12999993	missense	probably damaging	1.00
R5808:Mcf2l	UTSW	8	12993937	start codon destroyed	probably null	0.92
R5946:Mcf2l	UTSW	8	13013922	missense	probably damaging	1.00
R6168:Mcf2l	UTSW	8	13001823	missense	probably benign	0.05
R6174:Mcf2l	UTSW	8	13013849	nonsense	probably null
R6212:Mcf2l	UTSW	8	13017431	missense	probably damaging	1.00
R6270:Mcf2l	UTSW	8	13018701	missense	probably damaging	0.99
R6383:Mcf2l	UTSW	8	12879912	start gained	probably benign
R6850:Mcf2l	UTSW	8	13009476	missense	possibly damaging	0.82
R6908:Mcf2l	UTSW	8	13018919	missense	probably benign
R7101:Mcf2l	UTSW	8	13013579	missense	possibly damaging	0.80
R7163:Mcf2l	UTSW	8	12915439	missense	probably benign	0.00
R7203:Mcf2l	UTSW	8	13010456	missense	probably benign	0.09
R7414:Mcf2l	UTSW	8	13019022	makesense	probably null
R7553:Mcf2l	UTSW	8	12997268	missense	probably benign
R7556:Mcf2l	UTSW	8	12973071	missense	probably damaging	0.99
R7688:Mcf2l	UTSW	8	12948130	missense	possibly damaging	0.74
R7776:Mcf2l	UTSW	8	12880127	missense	probably benign
R7947:Mcf2l	UTSW	8	13003529	splice site	probably null
R8077:Mcf2l	UTSW	8	12998494	critical splice donor site	probably null
R8083:Mcf2l	UTSW	8	13007875	splice site	probably null
R8133:Mcf2l	UTSW	8	13011487	missense	probably damaging	1.00
R8189:Mcf2l	UTSW	8	12963164	missense	probably damaging	0.98
R8520:Mcf2l	UTSW	8	12880089	missense	probably benign
R8865:Mcf2l	UTSW	8	12880003	missense	probably benign	0.00
R8895:Mcf2l	UTSW	8	12984330	intron	probably benign
R9081:Mcf2l	UTSW	8	13018697	missense	probably damaging	0.96
R9143:Mcf2l	UTSW	8	13012883	splice site	probably benign
R9219:Mcf2l	UTSW	8	13011383	missense	probably damaging	0.98
R9229:Mcf2l	UTSW	8	13013584	missense	probably benign	0.01
R9335:Mcf2l	UTSW	8	13000812	missense	possibly damaging	0.92
R9351:Mcf2l	UTSW	8	13000757	missense	possibly damaging	0.82
R9406:Mcf2l	UTSW	8	13009676	missense	probably damaging	1.00
R9442:Mcf2l	UTSW	8	12973048	missense	possibly damaging	0.91
R9618:Mcf2l	UTSW	8	12984320	intron	probably benign
X0052:Mcf2l	UTSW	8	13018713	missense	possibly damaging	0.89
Z1177:Mcf2l	UTSW	8	13009654	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCACCAGTGTCCATGGAAGC -3'
(R):5'- CAACGTGCTCAGAACCTTCTC -3'

Sequencing Primer
(F):5'- TGTCCATGGAAGCCAGGTCTG -3'
(R):5'- CTTCCAAGCTGTTACTGAGAGGATC -3'

Posted On

2020-10-20