Incidental Mutation 'R0384:Matn1'
ID65487
Institutional Source Beutler Lab
Gene Symbol Matn1
Ensembl Gene ENSMUSG00000040533
Gene Namematrilin 1, cartilage matrix protein
SynonymsMat1, Crtm, CMP, matrilin-1
MMRRC Submission 038590-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0384 (G1)
Quality Score146
Status Validated
Chromosome4
Chromosomal Location130944385-130955475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130944476 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 18 (L18P)
Ref Sequence ENSEMBL: ENSMUSP00000099636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102576]
Predicted Effect probably benign
Transcript: ENSMUST00000102576
AA Change: L18P

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099636
Gene: ENSMUSG00000040533
AA Change: L18P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
VWA 43 225 5.5e-52 SMART
EGF 230 267 2.79e-4 SMART
VWA 277 456 1.76e-59 SMART
Matrilin_ccoil 454 500 1.8e-18 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of von Willebrand factor A domain containing protein family. This family of proteins are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. Mutations of this gene have been associated with variety of inherited chondrodysplasias. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are viable, fertile and display normal cartilage development and endochondral bone formation. Mice homozygous for one targeted allele show alterations in type II collagen fibrillogenesis and fibril organization, in the absence of skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam8 T A 7: 139,986,812 probably benign Het
Akr1b8 T C 6: 34,364,330 probably benign Het
Arhgef39 A G 4: 43,498,613 L117P probably damaging Het
Atp13a1 A T 8: 69,797,324 Q356L possibly damaging Het
Bmp2k T A 5: 97,031,125 probably benign Het
Ccdc141 A G 2: 77,027,648 V1063A probably damaging Het
Col20a1 T C 2: 180,999,162 Y568H probably benign Het
Crabp2 T C 3: 87,953,021 V134A possibly damaging Het
Cyp19a1 T C 9: 54,172,741 K265E probably benign Het
Cyp2j9 T C 4: 96,585,885 H106R probably benign Het
Dcps T C 9: 35,175,943 K9R probably damaging Het
Dnajc6 C T 4: 101,598,956 T47I probably damaging Het
Dnhd1 T G 7: 105,720,114 S4315A possibly damaging Het
Dnmt3l A T 10: 78,052,737 I158F possibly damaging Het
Dock3 A G 9: 106,901,895 probably benign Het
Eefsec A G 6: 88,281,650 probably null Het
Fam204a T C 19: 60,221,296 M1V probably null Het
Fam98b T C 2: 117,267,847 V266A possibly damaging Het
Fat2 A T 11: 55,269,465 I3274N possibly damaging Het
Fbxo18 A G 2: 11,749,578 I198T probably damaging Het
Fer T C 17: 63,924,184 probably benign Het
Fhad1 T A 4: 142,002,426 M89L probably benign Het
Fjx1 C A 2: 102,451,107 C161F probably damaging Het
Fkbp7 T A 2: 76,665,824 probably benign Het
Gm42669 T A 5: 107,508,798 C976S probably benign Het
Gm4845 T C 1: 141,257,085 noncoding transcript Het
Herc1 T A 9: 66,481,050 probably benign Het
Hook3 C T 8: 26,044,235 probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Itga2b A T 11: 102,465,362 probably null Het
Klk1b21 T C 7: 44,105,493 Y71H probably benign Het
Kndc1 A T 7: 139,910,599 N339I possibly damaging Het
Ky C T 9: 102,542,090 T432I probably benign Het
Map4 C T 9: 110,034,628 T307I probably damaging Het
Mindy4 G A 6: 55,216,684 D121N probably damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Msto1 G A 3: 88,910,339 Q441* probably null Het
Muc5ac A G 7: 141,812,251 H2048R possibly damaging Het
Musk T C 4: 58,373,711 *879Q probably null Het
Nat8f2 T C 6: 85,868,368 Y4C possibly damaging Het
Ncaph2 T A 15: 89,369,391 I282N probably benign Het
Nid1 A G 13: 13,463,836 T114A probably benign Het
Npr1 C A 3: 90,465,167 G113C probably damaging Het
Nrxn1 G A 17: 90,208,347 P193S probably damaging Het
Nwd2 T C 5: 63,805,682 F870L probably benign Het
Olfr1076 T A 2: 86,509,383 I308K possibly damaging Het
Olfr1228 A G 2: 89,249,070 I208T possibly damaging Het
Olfr55 A G 17: 33,176,548 I45V probably damaging Het
Olfr787 T A 10: 129,463,040 Y121* probably null Het
Phf14 A G 6: 11,997,020 probably benign Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm2 T C 4: 143,135,688 E344G probably benign Het
Psmd12 T C 11: 107,485,721 V61A probably benign Het
Relt T C 7: 100,847,505 D385G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scg2 T A 1: 79,435,549 I446F probably benign Het
Sema3b G A 9: 107,600,966 L407F probably damaging Het
Slc25a13 A T 6: 6,042,600 Y601* probably null Het
Sun5 C T 2: 153,858,965 V270I probably benign Het
Tex52 A G 6: 128,379,533 Y63C probably damaging Het
Tmem138 A G 19: 10,574,822 probably benign Het
Tnpo3 A G 6: 29,582,164 probably null Het
Tspoap1 A T 11: 87,766,454 Q364L probably damaging Het
Ttc41 T C 10: 86,763,947 L1037P probably damaging Het
Ugcg T A 4: 59,220,387 D393E possibly damaging Het
Vmn1r184 T C 7: 26,267,651 I274T probably benign Het
Vmn2r27 A G 6: 124,223,912 V362A probably benign Het
Vmn2r87 T A 10: 130,471,843 Y842F probably benign Het
Vps8 T A 16: 21,506,825 probably benign Het
Other mutations in Matn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Matn1 APN 4 130952974 missense probably benign
IGL01084:Matn1 APN 4 130951934 missense probably benign 0.13
IGL01123:Matn1 APN 4 130950011 missense possibly damaging 0.72
IGL01941:Matn1 APN 4 130952261 splice site probably benign
IGL02289:Matn1 APN 4 130951835 splice site probably benign
IGL02297:Matn1 APN 4 130952264 splice site probably benign
IGL02488:Matn1 APN 4 130944493 missense probably benign 0.20
IGL03493:Matn1 APN 4 130949998 missense probably benign 0.37
R0282:Matn1 UTSW 4 130945927 missense probably damaging 0.98
R0373:Matn1 UTSW 4 130950106 missense probably damaging 1.00
R1457:Matn1 UTSW 4 130950019 missense possibly damaging 0.89
R3955:Matn1 UTSW 4 130951415 critical splice donor site probably null
R4014:Matn1 UTSW 4 130951947 missense possibly damaging 0.69
R4801:Matn1 UTSW 4 130950025 missense possibly damaging 0.82
R4802:Matn1 UTSW 4 130950025 missense possibly damaging 0.82
R4887:Matn1 UTSW 4 130952114 missense probably benign 0.13
R4961:Matn1 UTSW 4 130952923 missense probably damaging 1.00
R6062:Matn1 UTSW 4 130951966 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAGCTGTAGGTCCAAGTCAGCAC -3'
(R):5'- ACAGACTGAGACAGGTCCTCCTTC -3'

Sequencing Primer
(F):5'- AAGTCAGCACGGGCTCTG -3'
(R):5'- ACCTCAGTTGCTGAGCATC -3'
Posted On2013-08-08