Incidental Mutation 'R8453:Rcl1'
ID 654902
Institutional Source Beutler Lab
Gene Symbol Rcl1
Ensembl Gene ENSMUSG00000024785
Gene Name RNA terminal phosphate cyclase-like 1
Synonyms RPCL1, 2310040A02Rik, Rnac
MMRRC Submission 067904-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R8453 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 29078761-29121251 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29093159 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 58 (I58T)
Ref Sequence ENSEMBL: ENSMUSP00000067579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064393]
AlphaFold Q9JJT0
Predicted Effect possibly damaging
Transcript: ENSMUST00000064393
AA Change: I58T

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067579
Gene: ENSMUSG00000024785
AA Change: I58T

DomainStartEndE-ValueType
Pfam:RTC 8 341 1.3e-61 PFAM
Pfam:RTC_insert 184 289 1.8e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik G T 9: 101,815,884 (GRCm39) C23F possibly damaging Het
Adam29 T C 8: 56,326,196 (GRCm39) H86R possibly damaging Het
Alas1 C T 9: 106,113,721 (GRCm39) R508Q possibly damaging Het
Albfm1 A T 5: 90,714,360 (GRCm39) R123S possibly damaging Het
Ark2n T C 18: 77,761,604 (GRCm39) E236G probably damaging Het
Bmp3 G A 5: 99,003,282 (GRCm39) probably null Het
Bud13 A G 9: 46,199,499 (GRCm39) T287A probably benign Het
C3 T C 17: 57,519,643 (GRCm39) E1203G probably benign Het
Carmil2 A C 8: 106,416,843 (GRCm39) Q476P probably damaging Het
Ccdc187 T A 2: 26,166,458 (GRCm39) T707S probably damaging Het
Cfap43 A T 19: 47,735,086 (GRCm39) V1435E probably damaging Het
Chrm3 A T 13: 9,927,267 (GRCm39) *590K probably null Het
Commd1 C T 11: 22,928,503 (GRCm39) probably benign Het
Creb3l1 A T 2: 91,821,274 (GRCm39) Y314* probably null Het
Ctc1 T A 11: 68,913,275 (GRCm39) S90R probably benign Het
Dixdc1 T C 9: 50,596,186 (GRCm39) Q413R probably benign Het
Dlg5 T C 14: 24,208,213 (GRCm39) T998A probably benign Het
Dnai4 A G 4: 102,917,113 (GRCm39) I577T possibly damaging Het
Eif1ad14 C T 12: 87,886,323 (GRCm39) S102N probably benign Het
Fam89b A G 19: 5,778,903 (GRCm39) S99P possibly damaging Het
Fbxo30 A G 10: 11,166,479 (GRCm39) I400M probably benign Het
Gad1 A T 2: 70,431,057 (GRCm39) M567L probably benign Het
Gemin5 T C 11: 58,016,065 (GRCm39) S1314G probably benign Het
Gm9195 T G 14: 72,678,201 (GRCm39) I2323L probably benign Het
Gria1 T A 11: 57,133,877 (GRCm39) F585L probably damaging Het
Hbs1l A T 10: 21,185,178 (GRCm39) H200L probably benign Het
Igsf5 A G 16: 96,222,996 (GRCm39) Q360R probably benign Het
Il31ra A T 13: 112,660,717 (GRCm39) V624E probably damaging Het
Iqsec3 T C 6: 121,364,779 (GRCm39) R837G probably damaging Het
Itprid2 T C 2: 79,475,129 (GRCm39) S363P probably benign Het
Lpl A G 8: 69,348,433 (GRCm39) I221V probably damaging Het
Mcf2l T C 8: 13,034,956 (GRCm39) probably null Het
Mink1 T A 11: 70,501,154 (GRCm39) D887E possibly damaging Het
Mmp10 T G 9: 7,508,203 (GRCm39) F443C probably damaging Het
Mmrn1 T A 6: 60,965,361 (GRCm39) Y1131N probably damaging Het
Mrc2 T A 11: 105,223,137 (GRCm39) V460E probably damaging Het
Nicn1 T A 9: 108,170,572 (GRCm39) F57Y probably damaging Het
Nlrp4b A G 7: 10,449,528 (GRCm39) Y577C probably damaging Het
Nrap T C 19: 56,312,352 (GRCm39) T1535A probably damaging Het
Opa1 G A 16: 29,439,686 (GRCm39) R755H probably damaging Het
P4htm C T 9: 108,457,566 (GRCm39) probably benign Het
Phldb2 A G 16: 45,645,385 (GRCm39) S354P probably benign Het
Phykpl T C 11: 51,489,121 (GRCm39) S316P probably damaging Het
Pnpla1 T A 17: 29,077,873 (GRCm39) D11E probably benign Het
Pold2 A G 11: 5,825,104 (GRCm39) F98L probably damaging Het
Prph G A 15: 98,954,657 (GRCm39) R241Q probably benign Het
Rps6ka2 A G 17: 7,514,151 (GRCm39) N117D probably benign Het
Sars1 G A 3: 108,336,029 (GRCm39) S331L probably benign Het
Scfd1 A C 12: 51,459,374 (GRCm39) K312Q possibly damaging Het
Senp5 A G 16: 31,808,166 (GRCm39) C363R probably benign Het
Senp7 A G 16: 56,008,691 (GRCm39) I1024V probably damaging Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,066,742 (GRCm39) probably benign Het
Sptbn4 A G 7: 27,103,663 (GRCm39) L1191P probably damaging Het
Stk40 A G 4: 126,022,766 (GRCm39) E180G probably damaging Het
Stxbp5 A T 10: 9,684,792 (GRCm39) V536E probably benign Het
Suco A T 1: 161,650,586 (GRCm39) probably benign Het
Tex15 G T 8: 34,066,899 (GRCm39) E2110* probably null Het
Thbs4 G A 13: 92,927,325 (GRCm39) P55S probably benign Het
Tmem115 T C 9: 107,411,997 (GRCm39) V107A probably benign Het
Tnfaip6 A C 2: 51,945,879 (GRCm39) I242L probably benign Het
Trabd G T 15: 88,969,616 (GRCm39) A270S possibly damaging Het
Trim30d T A 7: 104,136,947 (GRCm39) I86F probably damaging Het
Trpc7 A G 13: 56,970,372 (GRCm39) V404A probably benign Het
Vmn1r61 A G 7: 5,613,886 (GRCm39) Y143H probably benign Het
Vmn2r18 T A 5: 151,485,373 (GRCm39) D707V probably damaging Het
Vnn3 G A 10: 23,745,443 (GRCm39) R464H probably benign Het
Wdr27 T C 17: 15,112,751 (GRCm39) T652A probably benign Het
Yeats2 C T 16: 20,041,637 (GRCm39) R1176* probably null Het
Other mutations in Rcl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Rcl1 APN 19 29,098,662 (GRCm39) splice site probably null
IGL01514:Rcl1 APN 19 29,120,698 (GRCm39) utr 3 prime probably benign
IGL02625:Rcl1 APN 19 29,095,741 (GRCm39) missense probably benign 0.04
R0512:Rcl1 UTSW 19 29,105,497 (GRCm39) missense probably damaging 1.00
R2249:Rcl1 UTSW 19 29,099,268 (GRCm39) missense possibly damaging 0.46
R3610:Rcl1 UTSW 19 29,095,630 (GRCm39) missense probably benign 0.00
R4415:Rcl1 UTSW 19 29,095,762 (GRCm39) missense probably benign 0.01
R5324:Rcl1 UTSW 19 29,105,401 (GRCm39) missense probably benign 0.23
R5679:Rcl1 UTSW 19 29,098,658 (GRCm39) splice site probably null
R5988:Rcl1 UTSW 19 29,099,167 (GRCm39) missense probably damaging 1.00
R7332:Rcl1 UTSW 19 29,108,096 (GRCm39) missense probably benign 0.03
R7936:Rcl1 UTSW 19 29,095,805 (GRCm39) splice site probably null
R8353:Rcl1 UTSW 19 29,093,159 (GRCm39) missense possibly damaging 0.95
R9282:Rcl1 UTSW 19 29,093,170 (GRCm39) missense probably damaging 0.99
R9747:Rcl1 UTSW 19 29,105,482 (GRCm39) missense probably damaging 0.98
Z1176:Rcl1 UTSW 19 29,079,017 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGCCCTTAGCCTGTGATTG -3'
(R):5'- TCCACTTAGCACAACCTTGG -3'

Sequencing Primer
(F):5'- CCTGTGATTGAGCTGTCAGCC -3'
(R):5'- TGTCCGAGTAGTAACGTAG -3'
Posted On 2020-10-20