Mutagenetix > Incidental Mutations

Incidental Mutation 'R8454:Dusp27'

654906

Institutional Source

Beutler Lab

Gene Symbol

Dusp27

Ensembl Gene

ENSMUSG00000026564

Gene Name

dual specificity phosphatase 27 (putative)

Synonyms

C130085G02Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8454 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

166098148-166127922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 166108133 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 165 (N165K)

Ref Sequence

ENSEMBL: ENSMUSP00000083155 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085992] [ENSMUST00000192369]

Predicted Effect

probably damaging
Transcript: ENSMUST00000085992
AA Change: N165K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000083155
Gene: ENSMUSG00000026564
AA Change: N165K

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
DSPc	133	277	2.45e-30	SMART
low complexity region	339	348	N/A	INTRINSIC
low complexity region	404	425	N/A	INTRINSIC
low complexity region	429	439	N/A	INTRINSIC
low complexity region	618	635	N/A	INTRINSIC
low complexity region	655	666	N/A	INTRINSIC
low complexity region	773	788	N/A	INTRINSIC
coiled coil region	813	839	N/A	INTRINSIC
low complexity region	851	860	N/A	INTRINSIC
low complexity region	936	950	N/A	INTRINSIC
low complexity region	1001	1019	N/A	INTRINSIC
low complexity region	1026	1040	N/A	INTRINSIC
low complexity region	1074	1091	N/A	INTRINSIC
low complexity region	1108	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000192369
AA Change: N165K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141564
Gene: ENSMUSG00000026564
AA Change: N165K

Domain	Start	End	E-Value	Type
low complexity region	6	20	N/A	INTRINSIC
DSPc	133	277	2.45e-30	SMART
low complexity region	339	348	N/A	INTRINSIC
low complexity region	404	425	N/A	INTRINSIC
low complexity region	429	439	N/A	INTRINSIC
low complexity region	618	635	N/A	INTRINSIC
low complexity region	655	666	N/A	INTRINSIC
low complexity region	773	788	N/A	INTRINSIC
coiled coil region	813	839	N/A	INTRINSIC
low complexity region	851	860	N/A	INTRINSIC
low complexity region	936	950	N/A	INTRINSIC
low complexity region	1001	1019	N/A	INTRINSIC
low complexity region	1026	1040	N/A	INTRINSIC
low complexity region	1074	1091	N/A	INTRINSIC
low complexity region	1108	1120	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	A	7: 118,792,572	F493Y	probably benign	Het
Abcc10	C	A	17: 46,324,177	G300V	possibly damaging	Het
Adgrg7	C	G	16: 56,795,682		probably benign	Het
Agt	G	A	8: 124,564,103	T155M	probably benign	Het
Atp8b3	A	G	10: 80,525,799	V763A	probably benign	Het
Btn1a1	C	A	13: 23,464,250	V138L	probably benign	Het
Cd163	A	T	6: 124,328,965	N1109I	probably benign	Het
Cideb	T	A	14: 55,755,141	Q106L	possibly damaging	Het
Cntn1	A	G	15: 92,232,249	T126A	probably benign	Het
Elfn1	T	C	5: 139,971,471	Y77H	probably damaging	Het
Eml3	A	G	19: 8,934,994	H386R	probably damaging	Het
Fbxo21	A	G	5: 117,995,414	D413G	probably damaging	Het
Fkbp8	T	A	8: 70,531,763		probably null	Het
Fzd1	T	C	5: 4,757,336	Q82R	probably benign	Het
Gast	T	C	11: 100,336,568	L29P	probably benign	Het
Glb1l2	C	A	9: 26,806,417		probably benign	Het
Gm1110	C	G	9: 26,883,280	Q483H	probably benign	Het
Gm1110	T	A	9: 26,883,281	Q483L	probably benign	Het
Gm5737	T	A	7: 120,831,180	V420E	possibly damaging	Het
Gpc6	T	C	14: 116,925,979	L15P	probably damaging	Het
Hagh	C	A	17: 24,857,562	S161*	probably null	Het
Hrh1	A	G	6: 114,480,853	D365G	probably benign	Het
Ighv1-36	A	T	12: 114,879,940	M100K	probably damaging	Het
Itgb8	A	T	12: 119,170,778	V518D	probably benign	Het
Krt82	T	C	15: 101,541,803	Y486C	probably damaging	Het
Lmbr1l	A	G	15: 98,912,476	S85P	probably damaging	Het
Met	A	G	6: 17,491,769	S177G	probably damaging	Het
Myl9	T	A	2: 156,781,128	I162N	possibly damaging	Het
Npat	T	A	9: 53,566,951	N973K	possibly damaging	Het
Olfr493	A	T	7: 108,346,682	C100S	probably damaging	Het
Pcdhga12	A	T	18: 37,768,137	D674V	possibly damaging	Het
Phtf1	T	A	3: 104,004,449	N702K	probably damaging	Het
Plaa	A	T	4: 94,569,477	I752N	probably damaging	Het
Pnpla2	T	C	7: 141,458,098	C194R	probably damaging	Het
Rnaseh2a	T	C	8: 84,965,147	N133S	probably benign	Het
Rps6ka1	T	A	4: 133,848,553	Q685L	probably benign	Het
Ryr1	C	A	7: 29,015,717	G4661C	unknown	Het
Samd13	T	A	3: 146,646,402	M65L	probably benign	Het
Sec22c	A	G	9: 121,695,655	S21P	probably damaging	Het
Sh3d19	C	A	3: 86,107,022	T431K	probably benign	Het
Sin3b	A	G	8: 72,741,480	M277V	probably benign	Het
Sis	T	C	3: 72,947,501	T468A	possibly damaging	Het
Slitrk3	T	C	3: 73,049,180	N753S	probably benign	Het
Slitrk6	C	A	14: 110,752,046	L76F	probably damaging	Het
Stk3	C	T	15: 34,876,724	A478T	probably damaging	Het
Sugp1	C	A	8: 70,071,597	Y617*	probably null	Het
Tinag	T	C	9: 77,031,695	D167G	probably damaging	Het
Tk2	A	G	8: 104,241,114		probably null	Het
Tmem209	A	T	6: 30,489,309	V514D	probably damaging	Het
Tmprss9	A	G	10: 80,887,486	H260R	probably benign	Het
Tnfrsf14	T	A	4: 154,926,655	Y83F	possibly damaging	Het
Tnfrsf8	A	T	4: 145,287,983	D285E	probably benign	Het
Togaram2	C	G	17: 71,697,878	A310G	probably benign	Het
Trpv3	A	G	11: 73,291,622	Y544C	probably damaging	Het
Ttl	T	A	2: 129,066,184	V13D	probably damaging	Het
Usp40	A	T	1: 87,980,972	D602E	probably benign	Het
Vamp5	A	G	6: 72,370,393		probably benign	Het
Vmn2r65	T	A	7: 84,940,194	H838L	possibly damaging	Het
Wdr63	T	C	3: 146,097,227	K70E	probably damaging	Het
Zfp960	T	A	17: 17,088,199	Y392N	probably benign	Het

Other mutations in Dusp27

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00706:Dusp27	APN	1	166100552	missense	probably benign	0.00
IGL00973:Dusp27	APN	1	166099458	missense	probably benign
IGL01331:Dusp27	APN	1	166108180	missense	probably damaging	1.00
IGL01466:Dusp27	APN	1	166100504	missense	probably damaging	1.00
IGL01572:Dusp27	APN	1	166100372	missense	probably benign	0.18
IGL01906:Dusp27	APN	1	166099523	missense	probably damaging	1.00
IGL01974:Dusp27	APN	1	166100536	nonsense	probably null
IGL02112:Dusp27	APN	1	166099671	nonsense	probably null
IGL02805:Dusp27	APN	1	166099061	missense	probably damaging	1.00
IGL03343:Dusp27	APN	1	166099448	missense	probably benign	0.00
R0116:Dusp27	UTSW	1	166099701	missense	probably benign	0.19
R0367:Dusp27	UTSW	1	166100763	missense	probably benign	0.05
R0499:Dusp27	UTSW	1	166099101	missense	probably benign	0.00
R0542:Dusp27	UTSW	1	166101284	missense	possibly damaging	0.90
R1312:Dusp27	UTSW	1	166099291	missense	possibly damaging	0.46
R1572:Dusp27	UTSW	1	166099455	missense	possibly damaging	0.68
R1598:Dusp27	UTSW	1	166110259	missense	probably benign	0.10
R1858:Dusp27	UTSW	1	166100846	missense	possibly damaging	0.87
R2021:Dusp27	UTSW	1	166100823	missense	probably benign	0.00
R2970:Dusp27	UTSW	1	166099229	missense	probably benign	0.04
R3727:Dusp27	UTSW	1	166099506	missense	probably damaging	1.00
R4041:Dusp27	UTSW	1	166100111	missense	probably benign	0.01
R4245:Dusp27	UTSW	1	166101116	missense	probably damaging	1.00
R4955:Dusp27	UTSW	1	166108092	missense	probably damaging	1.00
R4967:Dusp27	UTSW	1	166127106	missense	probably damaging	1.00
R5040:Dusp27	UTSW	1	166100345	missense	probably benign	0.17
R5342:Dusp27	UTSW	1	166110250	missense	probably benign	0.01
R5467:Dusp27	UTSW	1	166112030	critical splice donor site	probably null
R5742:Dusp27	UTSW	1	166099454	missense	probably benign	0.00
R6222:Dusp27	UTSW	1	166098645	missense	probably benign	0.26
R6239:Dusp27	UTSW	1	166098819	missense	probably damaging	1.00
R6531:Dusp27	UTSW	1	166110046	splice site	probably null
R6586:Dusp27	UTSW	1	166100885	missense	possibly damaging	0.79
R6958:Dusp27	UTSW	1	166107996	missense	probably damaging	1.00
R7006:Dusp27	UTSW	1	166099094	missense	probably benign
R7111:Dusp27	UTSW	1	166127154	missense	possibly damaging	0.66
R7310:Dusp27	UTSW	1	166098731	missense	possibly damaging	0.46
R7312:Dusp27	UTSW	1	166127107	missense	probably damaging	0.99
R7378:Dusp27	UTSW	1	166112063	nonsense	probably null
R7398:Dusp27	UTSW	1	166100475	missense	probably damaging	1.00
R7442:Dusp27	UTSW	1	166101015	missense	probably benign	0.01
R7569:Dusp27	UTSW	1	166108035	missense	probably damaging	1.00
R7920:Dusp27	UTSW	1	166099896	missense	possibly damaging	0.72
R7954:Dusp27	UTSW	1	166099280	missense	probably benign	0.05
R7972:Dusp27	UTSW	1	166099139	missense	probably damaging	1.00
R8186:Dusp27	UTSW	1	166100079	missense	probably damaging	1.00
R8354:Dusp27	UTSW	1	166108133	missense	probably damaging	1.00
R8535:Dusp27	UTSW	1	166101161	missense	probably benign	0.01
Z1088:Dusp27	UTSW	1	166099283	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATTTCCAACTGCCAGGAAC -3'
(R):5'- TGGCCCCTCTTTTATTAAAGGTG -3'

Sequencing Primer
(F):5'- AACTGCCAGGAACCTGCAGG -3'
(R):5'- AGGTGTTAACTGTGAGCCCAC -3'

Posted On

2020-10-20