Incidental Mutation 'R8454:Myl9'
ID654908
Institutional Source Beutler Lab
Gene Symbol Myl9
Ensembl Gene ENSMUSG00000067818
Gene Namemyosin, light polypeptide 9, regulatory
SynonymsMylc2c, RLC-C, MLC20
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R8454 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location156775420-156781658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 156781128 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 162 (I162N)
Ref Sequence ENSEMBL: ENSMUSP00000085913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088552]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088552
AA Change: I162N

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000085913
Gene: ENSMUSG00000067818
AA Change: I162N

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
EFh 33 61 1.26e-7 SMART
EFh 102 130 1.15e0 SMART
Blast:EFh 138 166 4e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin, a structural component of muscle, consists of two heavy chains and four light chains. The protein encoded by this gene is a myosin light chain that may regulate muscle contraction by modulating the ATPase activity of myosin heads. The encoded protein binds calcium and is activated by myosin light chain kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,792,572 F493Y probably benign Het
Abcc10 C A 17: 46,324,177 G300V possibly damaging Het
Adgrg7 C G 16: 56,795,682 probably benign Het
Agt G A 8: 124,564,103 T155M probably benign Het
Atp8b3 A G 10: 80,525,799 V763A probably benign Het
Btn1a1 C A 13: 23,464,250 V138L probably benign Het
Cd163 A T 6: 124,328,965 N1109I probably benign Het
Cideb T A 14: 55,755,141 Q106L possibly damaging Het
Cntn1 A G 15: 92,232,249 T126A probably benign Het
Dusp27 A T 1: 166,108,133 N165K probably damaging Het
Elfn1 T C 5: 139,971,471 Y77H probably damaging Het
Eml3 A G 19: 8,934,994 H386R probably damaging Het
Fbxo21 A G 5: 117,995,414 D413G probably damaging Het
Fkbp8 T A 8: 70,531,763 probably null Het
Fzd1 T C 5: 4,757,336 Q82R probably benign Het
Gast T C 11: 100,336,568 L29P probably benign Het
Glb1l2 C A 9: 26,806,417 probably benign Het
Gm1110 C G 9: 26,883,280 Q483H probably benign Het
Gm1110 T A 9: 26,883,281 Q483L probably benign Het
Gm5737 T A 7: 120,831,180 V420E possibly damaging Het
Gpc6 T C 14: 116,925,979 L15P probably damaging Het
Hagh C A 17: 24,857,562 S161* probably null Het
Hrh1 A G 6: 114,480,853 D365G probably benign Het
Ighv1-36 A T 12: 114,879,940 M100K probably damaging Het
Itgb8 A T 12: 119,170,778 V518D probably benign Het
Krt82 T C 15: 101,541,803 Y486C probably damaging Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Met A G 6: 17,491,769 S177G probably damaging Het
Npat T A 9: 53,566,951 N973K possibly damaging Het
Olfr493 A T 7: 108,346,682 C100S probably damaging Het
Pcdhga12 A T 18: 37,768,137 D674V possibly damaging Het
Phtf1 T A 3: 104,004,449 N702K probably damaging Het
Plaa A T 4: 94,569,477 I752N probably damaging Het
Pnpla2 T C 7: 141,458,098 C194R probably damaging Het
Rnaseh2a T C 8: 84,965,147 N133S probably benign Het
Rps6ka1 T A 4: 133,848,553 Q685L probably benign Het
Ryr1 C A 7: 29,015,717 G4661C unknown Het
Samd13 T A 3: 146,646,402 M65L probably benign Het
Sec22c A G 9: 121,695,655 S21P probably damaging Het
Sh3d19 C A 3: 86,107,022 T431K probably benign Het
Sin3b A G 8: 72,741,480 M277V probably benign Het
Sis T C 3: 72,947,501 T468A possibly damaging Het
Slitrk3 T C 3: 73,049,180 N753S probably benign Het
Slitrk6 C A 14: 110,752,046 L76F probably damaging Het
Stk3 C T 15: 34,876,724 A478T probably damaging Het
Sugp1 C A 8: 70,071,597 Y617* probably null Het
Tinag T C 9: 77,031,695 D167G probably damaging Het
Tk2 A G 8: 104,241,114 probably null Het
Tmem209 A T 6: 30,489,309 V514D probably damaging Het
Tmprss9 A G 10: 80,887,486 H260R probably benign Het
Tnfrsf14 T A 4: 154,926,655 Y83F possibly damaging Het
Tnfrsf8 A T 4: 145,287,983 D285E probably benign Het
Togaram2 C G 17: 71,697,878 A310G probably benign Het
Trpv3 A G 11: 73,291,622 Y544C probably damaging Het
Ttl T A 2: 129,066,184 V13D probably damaging Het
Usp40 A T 1: 87,980,972 D602E probably benign Het
Vamp5 A G 6: 72,370,393 probably benign Het
Vmn2r65 T A 7: 84,940,194 H838L possibly damaging Het
Wdr63 T C 3: 146,097,227 K70E probably damaging Het
Zfp960 T A 17: 17,088,199 Y392N probably benign Het
Other mutations in Myl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:Myl9 APN 2 156778659 missense probably damaging 0.99
IGL02536:Myl9 APN 2 156778549 missense probably damaging 1.00
R2679:Myl9 UTSW 2 156780506 missense probably damaging 1.00
R5614:Myl9 UTSW 2 156781163 utr 3 prime probably benign
R8354:Myl9 UTSW 2 156781128 missense possibly damaging 0.63
X0010:Myl9 UTSW 2 156780578 missense probably damaging 1.00
X0021:Myl9 UTSW 2 156781098 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGTCATTAACCCAGTCGTGCC -3'
(R):5'- TCCTTGTAGGGTCAGAGATCCC -3'

Sequencing Primer
(F):5'- AGTCGTGCCGTGCCTCAG -3'
(R):5'- AGGGTCAGAGATCCCTTCTAG -3'
Posted On2020-10-20