Mutagenetix > Incidental Mutations

Incidental Mutation 'R8454:Slitrk3'

654910

Institutional Source

Beutler Lab

Gene Symbol

Slitrk3

Ensembl Gene

ENSMUSG00000048304

Gene Name

SLIT and NTRK-like family, member 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.760) question?

Stock #

R8454 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

73047265-73057803 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73049180 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 753 (N753S)

Ref Sequence

ENSEMBL: ENSMUSP00000088561 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059407] [ENSMUST00000192477]

Predicted Effect

probably benign
Transcript: ENSMUST00000059407
AA Change: N753S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000088561
Gene: ENSMUSG00000048304
AA Change: N753S

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Blast:LRRNT	44	79	3e-11	BLAST
LRR	101	124	2.08e1	SMART
LRR	125	148	6.05e0	SMART
LRR	149	172	3.97e0	SMART
LRR_TYP	173	196	1.67e-2	SMART
LRR	197	220	2.69e2	SMART
LRRCT	233	283	4.56e-5	SMART
low complexity region	332	350	N/A	INTRINSIC
LRRNT	373	411	4.17e0	SMART
LRR	432	455	1.62e0	SMART
LRR_TYP	456	479	2.61e-4	SMART
LRR	480	503	2.82e0	SMART
LRR_TYP	504	527	6.99e-5	SMART
LRRCT	563	613	3.22e-5	SMART
transmembrane domain	658	680	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	836	843	N/A	INTRINSIC
low complexity region	846	858	N/A	INTRINSIC
low complexity region	870	888	N/A	INTRINSIC
Blast:LRRCT	906	943	2e-16	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000192477
AA Change: N753S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000141236
Gene: ENSMUSG00000048304
AA Change: N753S

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Blast:LRRNT	44	79	3e-11	BLAST
LRR	101	124	2.08e1	SMART
LRR	125	148	6.05e0	SMART
LRR	149	172	3.97e0	SMART
LRR_TYP	173	196	1.67e-2	SMART
LRR	197	220	2.69e2	SMART
LRRCT	233	283	4.56e-5	SMART
low complexity region	332	350	N/A	INTRINSIC
LRRNT	373	411	4.17e0	SMART
LRR	432	455	1.62e0	SMART
LRR_TYP	456	479	2.61e-4	SMART
LRR	480	503	2.82e0	SMART
LRR_TYP	504	527	6.99e-5	SMART
LRRCT	563	613	3.22e-5	SMART
transmembrane domain	658	680	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	836	843	N/A	INTRINSIC
low complexity region	846	858	N/A	INTRINSIC
low complexity region	870	888	N/A	INTRINSIC
Blast:LRRCT	906	943	2e-16	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Slitrk family of structurally related transmembrane proteins that are involved in controlling neurite outgrowth. The encoded protein contains two leucine-rich repeat (LRR) domains and a C-terminal domain that is partially similar to Trk neurotrophin receptor protein. Enhanced expression of this gene was found in tissue from several different types of tumors. Alternative splicing results in multiple transcript variants, all encoding the same protein. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out mice exhibit reduced inhibitory synapse density, decreased miniature inhibitory postsynaptic current frequency and increased susceptibility to spontaneous and pharmacologically-induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	A	7: 118,792,572	F493Y	probably benign	Het
Abcc10	C	A	17: 46,324,177	G300V	possibly damaging	Het
Adgrg7	C	G	16: 56,795,682		probably benign	Het
Agt	G	A	8: 124,564,103	T155M	probably benign	Het
Atp8b3	A	G	10: 80,525,799	V763A	probably benign	Het
Btn1a1	C	A	13: 23,464,250	V138L	probably benign	Het
Cd163	A	T	6: 124,328,965	N1109I	probably benign	Het
Cideb	T	A	14: 55,755,141	Q106L	possibly damaging	Het
Cntn1	A	G	15: 92,232,249	T126A	probably benign	Het
Dusp27	A	T	1: 166,108,133	N165K	probably damaging	Het
Elfn1	T	C	5: 139,971,471	Y77H	probably damaging	Het
Eml3	A	G	19: 8,934,994	H386R	probably damaging	Het
Fbxo21	A	G	5: 117,995,414	D413G	probably damaging	Het
Fkbp8	T	A	8: 70,531,763		probably null	Het
Fzd1	T	C	5: 4,757,336	Q82R	probably benign	Het
Gast	T	C	11: 100,336,568	L29P	probably benign	Het
Glb1l2	C	A	9: 26,806,417		probably benign	Het
Gm1110	C	G	9: 26,883,280	Q483H	probably benign	Het
Gm1110	T	A	9: 26,883,281	Q483L	probably benign	Het
Gm5737	T	A	7: 120,831,180	V420E	possibly damaging	Het
Gpc6	T	C	14: 116,925,979	L15P	probably damaging	Het
Hagh	C	A	17: 24,857,562	S161*	probably null	Het
Hrh1	A	G	6: 114,480,853	D365G	probably benign	Het
Ighv1-36	A	T	12: 114,879,940	M100K	probably damaging	Het
Itgb8	A	T	12: 119,170,778	V518D	probably benign	Het
Krt82	T	C	15: 101,541,803	Y486C	probably damaging	Het
Lmbr1l	A	G	15: 98,912,476	S85P	probably damaging	Het
Met	A	G	6: 17,491,769	S177G	probably damaging	Het
Myl9	T	A	2: 156,781,128	I162N	possibly damaging	Het
Npat	T	A	9: 53,566,951	N973K	possibly damaging	Het
Olfr493	A	T	7: 108,346,682	C100S	probably damaging	Het
Pcdhga12	A	T	18: 37,768,137	D674V	possibly damaging	Het
Phtf1	T	A	3: 104,004,449	N702K	probably damaging	Het
Plaa	A	T	4: 94,569,477	I752N	probably damaging	Het
Pnpla2	T	C	7: 141,458,098	C194R	probably damaging	Het
Rnaseh2a	T	C	8: 84,965,147	N133S	probably benign	Het
Rps6ka1	T	A	4: 133,848,553	Q685L	probably benign	Het
Ryr1	C	A	7: 29,015,717	G4661C	unknown	Het
Samd13	T	A	3: 146,646,402	M65L	probably benign	Het
Sec22c	A	G	9: 121,695,655	S21P	probably damaging	Het
Sh3d19	C	A	3: 86,107,022	T431K	probably benign	Het
Sin3b	A	G	8: 72,741,480	M277V	probably benign	Het
Sis	T	C	3: 72,947,501	T468A	possibly damaging	Het
Slitrk6	C	A	14: 110,752,046	L76F	probably damaging	Het
Stk3	C	T	15: 34,876,724	A478T	probably damaging	Het
Sugp1	C	A	8: 70,071,597	Y617*	probably null	Het
Tinag	T	C	9: 77,031,695	D167G	probably damaging	Het
Tk2	A	G	8: 104,241,114		probably null	Het
Tmem209	A	T	6: 30,489,309	V514D	probably damaging	Het
Tmprss9	A	G	10: 80,887,486	H260R	probably benign	Het
Tnfrsf14	T	A	4: 154,926,655	Y83F	possibly damaging	Het
Tnfrsf8	A	T	4: 145,287,983	D285E	probably benign	Het
Togaram2	C	G	17: 71,697,878	A310G	probably benign	Het
Trpv3	A	G	11: 73,291,622	Y544C	probably damaging	Het
Ttl	T	A	2: 129,066,184	V13D	probably damaging	Het
Usp40	A	T	1: 87,980,972	D602E	probably benign	Het
Vamp5	A	G	6: 72,370,393		probably benign	Het
Vmn2r65	T	A	7: 84,940,194	H838L	possibly damaging	Het
Wdr63	T	C	3: 146,097,227	K70E	probably damaging	Het
Zfp960	T	A	17: 17,088,199	Y392N	probably benign	Het

Other mutations in Slitrk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Slitrk3	APN	3	73051103	missense	probably damaging	1.00
IGL00857:Slitrk3	APN	3	73049841	missense	probably damaging	1.00
IGL00990:Slitrk3	APN	3	73050081	missense	probably damaging	1.00
IGL01010:Slitrk3	APN	3	73049273	missense	probably benign	0.14
IGL01299:Slitrk3	APN	3	73049016	missense	probably benign	0.43
IGL01609:Slitrk3	APN	3	73050237	missense	probably damaging	1.00
IGL01881:Slitrk3	APN	3	73049306	missense	probably benign	0.00
IGL01941:Slitrk3	APN	3	73051071	missense	possibly damaging	0.72
IGL02183:Slitrk3	APN	3	73049979	missense	probably damaging	0.97
IGL02187:Slitrk3	APN	3	73050272	missense	probably damaging	1.00
IGL02478:Slitrk3	APN	3	73050713	missense	probably damaging	0.96
IGL02512:Slitrk3	APN	3	73050402	missense	probably benign	0.28
IGL02720:Slitrk3	APN	3	73050768	missense	probably damaging	1.00
IGL03113:Slitrk3	APN	3	73050390	missense	probably benign	0.00
IGL03224:Slitrk3	APN	3	73049930	missense	possibly damaging	0.72
wee	UTSW	3	73050785	missense	probably damaging	1.00
R0233:Slitrk3	UTSW	3	73048577	missense	probably benign	0.00
R0233:Slitrk3	UTSW	3	73048577	missense	probably benign	0.00
R0639:Slitrk3	UTSW	3	73049649	missense	probably benign	0.02
R1448:Slitrk3	UTSW	3	73050341	missense	probably damaging	0.99
R1656:Slitrk3	UTSW	3	73050339	missense	probably damaging	0.98
R1713:Slitrk3	UTSW	3	73049691	missense	probably benign	0.00
R1992:Slitrk3	UTSW	3	73049771	missense	possibly damaging	0.80
R1999:Slitrk3	UTSW	3	73049964	missense	probably benign	0.13
R2359:Slitrk3	UTSW	3	73049345	missense	possibly damaging	0.56
R3083:Slitrk3	UTSW	3	73048595	missense	probably benign	0.00
R3153:Slitrk3	UTSW	3	73048982	nonsense	probably null
R3821:Slitrk3	UTSW	3	73049216	missense	possibly damaging	0.94
R4208:Slitrk3	UTSW	3	73051157	missense	possibly damaging	0.67
R4323:Slitrk3	UTSW	3	73050785	missense	probably damaging	1.00
R4580:Slitrk3	UTSW	3	73051206	missense	probably damaging	0.96
R4730:Slitrk3	UTSW	3	73049519	missense	probably benign	0.08
R4742:Slitrk3	UTSW	3	73048565	missense	probably benign	0.00
R4979:Slitrk3	UTSW	3	73049796	missense	possibly damaging	0.95
R5018:Slitrk3	UTSW	3	73050512	missense	probably benign	0.31
R5023:Slitrk3	UTSW	3	73050648	missense	probably benign	0.24
R5057:Slitrk3	UTSW	3	73050648	missense	probably benign	0.24
R5156:Slitrk3	UTSW	3	73049259	missense	probably benign
R5500:Slitrk3	UTSW	3	73050347	missense	probably damaging	1.00
R5582:Slitrk3	UTSW	3	73050404	missense	probably benign	0.09
R5797:Slitrk3	UTSW	3	73048629	missense	probably damaging	0.99
R5963:Slitrk3	UTSW	3	73050713	missense	probably benign	0.30
R5985:Slitrk3	UTSW	3	73050900	missense	probably damaging	1.00
R6123:Slitrk3	UTSW	3	73049762	missense	probably damaging	1.00
R6393:Slitrk3	UTSW	3	73049914	missense	possibly damaging	0.79
R6529:Slitrk3	UTSW	3	73051218	missense	probably benign	0.02
R6584:Slitrk3	UTSW	3	73049225	missense	probably damaging	0.99
R6645:Slitrk3	UTSW	3	73049861	missense	probably benign	0.13
R7001:Slitrk3	UTSW	3	73050609	nonsense	probably null
R7282:Slitrk3	UTSW	3	73050465	missense	possibly damaging	0.70
R7534:Slitrk3	UTSW	3	73050107	missense	probably damaging	0.98
R7577:Slitrk3	UTSW	3	73051115	missense	probably damaging	0.99
R7757:Slitrk3	UTSW	3	73050839	missense	probably damaging	1.00
R8251:Slitrk3	UTSW	3	73049396	missense	possibly damaging	0.67
R8354:Slitrk3	UTSW	3	73049180	missense	probably benign	0.08
R8488:Slitrk3	UTSW	3	73051187	missense	probably benign	0.02
R8491:Slitrk3	UTSW	3	73051259	missense	possibly damaging	0.89
X0022:Slitrk3	UTSW	3	73050266	missense	probably damaging	1.00
Z1176:Slitrk3	UTSW	3	73048770	missense	probably benign	0.09
Z1177:Slitrk3	UTSW	3	73049142	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTTCCAGCAAGGTCCTGTAG -3'
(R):5'- TCGGCGTAGGAAGAAGTTGC -3'

Sequencing Primer
(F):5'- CCAGCAAGGTCCTGTAGTTACTG -3'
(R):5'- TTGCCCTTTAGAAGCAAGAGAC -3'

Posted On

2020-10-20