Incidental Mutation 'R8454:Tnfrsf8'
ID654917
Institutional Source Beutler Lab
Gene Symbol Tnfrsf8
Ensembl Gene ENSMUSG00000028602
Gene Nametumor necrosis factor receptor superfamily, member 8
SynonymsCD30
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R8454 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location145267137-145315164 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 145287983 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 285 (D285E)
Ref Sequence ENSEMBL: ENSMUSP00000030339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030339] [ENSMUST00000123027]
Predicted Effect probably benign
Transcript: ENSMUST00000030339
AA Change: D285E

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030339
Gene: ENSMUSG00000028602
AA Change: D285E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TNFR 29 65 2.33e0 SMART
TNFR 69 105 5.51e-7 SMART
TNFR 107 146 2.87e-5 SMART
low complexity region 149 161 N/A INTRINSIC
transmembrane domain 288 310 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000123027
AA Change: D285E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118714
Gene: ENSMUSG00000028602
AA Change: D285E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
TNFR 29 65 2.33e0 SMART
TNFR 69 105 5.51e-7 SMART
TNFR 107 146 2.87e-5 SMART
low complexity region 149 161 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed by activated, but not by resting, T and B cells. TRAF2 and TRAF5 can interact with this receptor, and mediate the signal transduction that leads to the activation of NF-kappaB. This receptor is a positive regulator of apoptosis, and also has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display an enlarged thymus, impaired activation-induced death of double-positive thymocytes after CD3 cross-linking, and decreased susceptibility to graft versus host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,792,572 F493Y probably benign Het
Abcc10 C A 17: 46,324,177 G300V possibly damaging Het
Adgrg7 C G 16: 56,795,682 probably benign Het
Agt G A 8: 124,564,103 T155M probably benign Het
Atp8b3 A G 10: 80,525,799 V763A probably benign Het
Btn1a1 C A 13: 23,464,250 V138L probably benign Het
Cd163 A T 6: 124,328,965 N1109I probably benign Het
Cideb T A 14: 55,755,141 Q106L possibly damaging Het
Cntn1 A G 15: 92,232,249 T126A probably benign Het
Dusp27 A T 1: 166,108,133 N165K probably damaging Het
Elfn1 T C 5: 139,971,471 Y77H probably damaging Het
Eml3 A G 19: 8,934,994 H386R probably damaging Het
Fbxo21 A G 5: 117,995,414 D413G probably damaging Het
Fkbp8 T A 8: 70,531,763 probably null Het
Fzd1 T C 5: 4,757,336 Q82R probably benign Het
Gast T C 11: 100,336,568 L29P probably benign Het
Glb1l2 C A 9: 26,806,417 probably benign Het
Gm1110 C G 9: 26,883,280 Q483H probably benign Het
Gm1110 T A 9: 26,883,281 Q483L probably benign Het
Gm5737 T A 7: 120,831,180 V420E possibly damaging Het
Gpc6 T C 14: 116,925,979 L15P probably damaging Het
Hagh C A 17: 24,857,562 S161* probably null Het
Hrh1 A G 6: 114,480,853 D365G probably benign Het
Ighv1-36 A T 12: 114,879,940 M100K probably damaging Het
Itgb8 A T 12: 119,170,778 V518D probably benign Het
Krt82 T C 15: 101,541,803 Y486C probably damaging Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Met A G 6: 17,491,769 S177G probably damaging Het
Myl9 T A 2: 156,781,128 I162N possibly damaging Het
Npat T A 9: 53,566,951 N973K possibly damaging Het
Olfr493 A T 7: 108,346,682 C100S probably damaging Het
Pcdhga12 A T 18: 37,768,137 D674V possibly damaging Het
Phtf1 T A 3: 104,004,449 N702K probably damaging Het
Plaa A T 4: 94,569,477 I752N probably damaging Het
Pnpla2 T C 7: 141,458,098 C194R probably damaging Het
Rnaseh2a T C 8: 84,965,147 N133S probably benign Het
Rps6ka1 T A 4: 133,848,553 Q685L probably benign Het
Ryr1 C A 7: 29,015,717 G4661C unknown Het
Samd13 T A 3: 146,646,402 M65L probably benign Het
Sec22c A G 9: 121,695,655 S21P probably damaging Het
Sh3d19 C A 3: 86,107,022 T431K probably benign Het
Sin3b A G 8: 72,741,480 M277V probably benign Het
Sis T C 3: 72,947,501 T468A possibly damaging Het
Slitrk3 T C 3: 73,049,180 N753S probably benign Het
Slitrk6 C A 14: 110,752,046 L76F probably damaging Het
Stk3 C T 15: 34,876,724 A478T probably damaging Het
Sugp1 C A 8: 70,071,597 Y617* probably null Het
Tinag T C 9: 77,031,695 D167G probably damaging Het
Tk2 A G 8: 104,241,114 probably null Het
Tmem209 A T 6: 30,489,309 V514D probably damaging Het
Tmprss9 A G 10: 80,887,486 H260R probably benign Het
Tnfrsf14 T A 4: 154,926,655 Y83F possibly damaging Het
Togaram2 C G 17: 71,697,878 A310G probably benign Het
Trpv3 A G 11: 73,291,622 Y544C probably damaging Het
Ttl T A 2: 129,066,184 V13D probably damaging Het
Usp40 A T 1: 87,980,972 D602E probably benign Het
Vamp5 A G 6: 72,370,393 probably benign Het
Vmn2r65 T A 7: 84,940,194 H838L possibly damaging Het
Wdr63 T C 3: 146,097,227 K70E probably damaging Het
Zfp960 T A 17: 17,088,199 Y392N probably benign Het
Other mutations in Tnfrsf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tnfrsf8 APN 4 145292591 splice site probably null
IGL02815:Tnfrsf8 APN 4 145298778 missense possibly damaging 0.68
IGL02819:Tnfrsf8 APN 4 145269133 missense probably damaging 1.00
IGL03033:Tnfrsf8 APN 4 145292649 missense possibly damaging 0.86
IGL03105:Tnfrsf8 APN 4 145298784 missense probably damaging 1.00
IGL02837:Tnfrsf8 UTSW 4 145268998 missense probably benign 0.10
R0114:Tnfrsf8 UTSW 4 145288047 missense possibly damaging 0.95
R0326:Tnfrsf8 UTSW 4 145288459 missense possibly damaging 0.64
R0594:Tnfrsf8 UTSW 4 145296861 missense probably damaging 1.00
R0639:Tnfrsf8 UTSW 4 145288027 missense probably benign 0.24
R0826:Tnfrsf8 UTSW 4 145285138 splice site probably benign
R3056:Tnfrsf8 UTSW 4 145285325 critical splice donor site probably null
R4700:Tnfrsf8 UTSW 4 145303122 missense probably damaging 0.99
R4765:Tnfrsf8 UTSW 4 145296877 missense probably benign 0.19
R5149:Tnfrsf8 UTSW 4 145303105 missense possibly damaging 0.53
R5452:Tnfrsf8 UTSW 4 145292644 missense possibly damaging 0.96
R5632:Tnfrsf8 UTSW 4 145292633 missense possibly damaging 0.68
R5673:Tnfrsf8 UTSW 4 145285335 missense probably benign 0.14
R5877:Tnfrsf8 UTSW 4 145292687 missense probably benign 0.20
R6243:Tnfrsf8 UTSW 4 145303101 missense possibly damaging 0.61
R6259:Tnfrsf8 UTSW 4 145277524 critical splice donor site probably null
R6326:Tnfrsf8 UTSW 4 145269224 missense probably damaging 1.00
R6603:Tnfrsf8 UTSW 4 145292598 missense possibly damaging 0.70
R7025:Tnfrsf8 UTSW 4 145274403 missense possibly damaging 0.87
R7156:Tnfrsf8 UTSW 4 145315084 start codon destroyed unknown
R7313:Tnfrsf8 UTSW 4 145274382 missense probably benign 0.33
R7505:Tnfrsf8 UTSW 4 145269115 missense probably damaging 1.00
R8255:Tnfrsf8 UTSW 4 145315083 start codon destroyed probably null
R8354:Tnfrsf8 UTSW 4 145287983 missense probably benign 0.41
R8406:Tnfrsf8 UTSW 4 145292695 missense probably damaging 0.98
Z1177:Tnfrsf8 UTSW 4 145292709 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AGGCCATCAGAATGAAGTCATG -3'
(R):5'- GGCTTCATCTTTACCCTCTGTAGAG -3'

Sequencing Primer
(F):5'- AGGGTCAGTTCTAGAAGC -3'
(R):5'- TTACCCTCTGTAGAGAAGAAACATC -3'
Posted On2020-10-20