Incidental Mutation 'R8454:Tnfrsf14'
ID654918
Institutional Source Beutler Lab
Gene Symbol Tnfrsf14
Ensembl Gene ENSMUSG00000042333
Gene Nametumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator)
SynonymsAtar, Hvem, HveA
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8454 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location154921933-154928563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 154926655 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 83 (Y83F)
Ref Sequence ENSEMBL: ENSMUSP00000151575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123514] [ENSMUST00000137803] [ENSMUST00000145296] [ENSMUST00000152687] [ENSMUST00000219534]
Predicted Effect possibly damaging
Transcript: ENSMUST00000123514
AA Change: Y83F

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116757
Gene: ENSMUSG00000042333
AA Change: Y83F

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
TNFR 42 75 1.19e-2 SMART
TNFR 78 119 1.61e-8 SMART
TNFR 121 162 2.49e-5 SMART
TNFR 165 203 2.63e-4 SMART
transmembrane domain 208 230 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000137803
AA Change: Y28F

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000145296
AA Change: Y83F

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000152687
SMART Domains Protein: ENSMUSP00000117890
Gene: ENSMUSG00000042333

DomainStartEndE-ValueType
TNFR 37 78 2.49e-5 SMART
TNFR 81 119 2.63e-4 SMART
transmembrane domain 123 145 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000219534
AA Change: Y83F

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TNF (tumor necrosis factor) receptor superfamily. The encoded protein functions in signal transduction pathways that activate inflammatory and inhibitory T-cell immune response. It binds herpes simplex virus (HSV) viral envelope glycoprotein D (gD), mediating its entry into cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygotes for a null allele are less susceptible to induced colitis. Homozygotes for a second null allele exhibit enhanced responses to various T cell stimuli and are more susceptible to developing autoimmune diseases. Homozygotes for a third null allele show reduced length of allograft survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,792,572 F493Y probably benign Het
Abcc10 C A 17: 46,324,177 G300V possibly damaging Het
Adgrg7 C G 16: 56,795,682 probably benign Het
Agt G A 8: 124,564,103 T155M probably benign Het
Atp8b3 A G 10: 80,525,799 V763A probably benign Het
Btn1a1 C A 13: 23,464,250 V138L probably benign Het
Cd163 A T 6: 124,328,965 N1109I probably benign Het
Cideb T A 14: 55,755,141 Q106L possibly damaging Het
Cntn1 A G 15: 92,232,249 T126A probably benign Het
Dusp27 A T 1: 166,108,133 N165K probably damaging Het
Elfn1 T C 5: 139,971,471 Y77H probably damaging Het
Eml3 A G 19: 8,934,994 H386R probably damaging Het
Fbxo21 A G 5: 117,995,414 D413G probably damaging Het
Fkbp8 T A 8: 70,531,763 probably null Het
Fzd1 T C 5: 4,757,336 Q82R probably benign Het
Gast T C 11: 100,336,568 L29P probably benign Het
Glb1l2 C A 9: 26,806,417 probably benign Het
Gm1110 C G 9: 26,883,280 Q483H probably benign Het
Gm1110 T A 9: 26,883,281 Q483L probably benign Het
Gm5737 T A 7: 120,831,180 V420E possibly damaging Het
Gpc6 T C 14: 116,925,979 L15P probably damaging Het
Hagh C A 17: 24,857,562 S161* probably null Het
Hrh1 A G 6: 114,480,853 D365G probably benign Het
Ighv1-36 A T 12: 114,879,940 M100K probably damaging Het
Itgb8 A T 12: 119,170,778 V518D probably benign Het
Krt82 T C 15: 101,541,803 Y486C probably damaging Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Met A G 6: 17,491,769 S177G probably damaging Het
Myl9 T A 2: 156,781,128 I162N possibly damaging Het
Npat T A 9: 53,566,951 N973K possibly damaging Het
Olfr493 A T 7: 108,346,682 C100S probably damaging Het
Pcdhga12 A T 18: 37,768,137 D674V possibly damaging Het
Phtf1 T A 3: 104,004,449 N702K probably damaging Het
Plaa A T 4: 94,569,477 I752N probably damaging Het
Pnpla2 T C 7: 141,458,098 C194R probably damaging Het
Rnaseh2a T C 8: 84,965,147 N133S probably benign Het
Rps6ka1 T A 4: 133,848,553 Q685L probably benign Het
Ryr1 C A 7: 29,015,717 G4661C unknown Het
Samd13 T A 3: 146,646,402 M65L probably benign Het
Sec22c A G 9: 121,695,655 S21P probably damaging Het
Sh3d19 C A 3: 86,107,022 T431K probably benign Het
Sin3b A G 8: 72,741,480 M277V probably benign Het
Sis T C 3: 72,947,501 T468A possibly damaging Het
Slitrk3 T C 3: 73,049,180 N753S probably benign Het
Slitrk6 C A 14: 110,752,046 L76F probably damaging Het
Stk3 C T 15: 34,876,724 A478T probably damaging Het
Sugp1 C A 8: 70,071,597 Y617* probably null Het
Tinag T C 9: 77,031,695 D167G probably damaging Het
Tk2 A G 8: 104,241,114 probably null Het
Tmem209 A T 6: 30,489,309 V514D probably damaging Het
Tmprss9 A G 10: 80,887,486 H260R probably benign Het
Tnfrsf8 A T 4: 145,287,983 D285E probably benign Het
Togaram2 C G 17: 71,697,878 A310G probably benign Het
Trpv3 A G 11: 73,291,622 Y544C probably damaging Het
Ttl T A 2: 129,066,184 V13D probably damaging Het
Usp40 A T 1: 87,980,972 D602E probably benign Het
Vamp5 A G 6: 72,370,393 probably benign Het
Vmn2r65 T A 7: 84,940,194 H838L possibly damaging Het
Wdr63 T C 3: 146,097,227 K70E probably damaging Het
Zfp960 T A 17: 17,088,199 Y392N probably benign Het
Other mutations in Tnfrsf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02680:Tnfrsf14 APN 4 154924470 nonsense probably null
che UTSW 4 154925380 nonsense probably null
fidel UTSW 4 154926661 missense probably damaging 1.00
trotter UTSW 4 154926598 critical splice donor site probably null
R0271:Tnfrsf14 UTSW 4 154926597 critical splice donor site probably null
R0605:Tnfrsf14 UTSW 4 154925380 nonsense probably null
R1738:Tnfrsf14 UTSW 4 154925331 missense probably damaging 1.00
R1756:Tnfrsf14 UTSW 4 154925322 missense possibly damaging 0.90
R5371:Tnfrsf14 UTSW 4 154922477 splice site probably null
R5869:Tnfrsf14 UTSW 4 154926598 critical splice donor site probably null
R6113:Tnfrsf14 UTSW 4 154924492 missense possibly damaging 0.64
R7790:Tnfrsf14 UTSW 4 154923293 missense probably benign 0.00
R8015:Tnfrsf14 UTSW 4 154926661 missense probably damaging 1.00
R8354:Tnfrsf14 UTSW 4 154926655 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCCACAATAGCAGGAAGGTC -3'
(R):5'- TTGTTCATAGAGGGCAGACAG -3'

Sequencing Primer
(F):5'- AAGGTCAGGCTGCGGTTC -3'
(R):5'- AGGCCAACAAGTCCTGTG -3'
Posted On2020-10-20