Incidental Mutation 'R8454:Fzd1'
ID654919
Institutional Source Beutler Lab
Gene Symbol Fzd1
Ensembl Gene ENSMUSG00000044674
Gene Namefrizzled class receptor 1
SynonymsFZ-1, Fz1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8454 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location4753839-4758035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4757336 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 82 (Q82R)
Ref Sequence ENSEMBL: ENSMUSP00000058629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054294]
Predicted Effect probably benign
Transcript: ENSMUST00000054294
AA Change: Q82R

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000058629
Gene: ENSMUSG00000044674
AA Change: Q82R

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 54 67 N/A INTRINSIC
low complexity region 71 96 N/A INTRINSIC
FRI 110 227 7.77e-72 SMART
low complexity region 249 262 N/A INTRINSIC
Frizzled 304 635 4.18e-224 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD1 protein contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, 7 transmembrane domains, and a C-terminal PDZ domain-binding motif. The FZD1 transcript is expressed in various tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,792,572 F493Y probably benign Het
Abcc10 C A 17: 46,324,177 G300V possibly damaging Het
Adgrg7 C G 16: 56,795,682 probably benign Het
Agt G A 8: 124,564,103 T155M probably benign Het
Atp8b3 A G 10: 80,525,799 V763A probably benign Het
Btn1a1 C A 13: 23,464,250 V138L probably benign Het
Cd163 A T 6: 124,328,965 N1109I probably benign Het
Cideb T A 14: 55,755,141 Q106L possibly damaging Het
Cntn1 A G 15: 92,232,249 T126A probably benign Het
Dusp27 A T 1: 166,108,133 N165K probably damaging Het
Elfn1 T C 5: 139,971,471 Y77H probably damaging Het
Eml3 A G 19: 8,934,994 H386R probably damaging Het
Fbxo21 A G 5: 117,995,414 D413G probably damaging Het
Fkbp8 T A 8: 70,531,763 probably null Het
Gast T C 11: 100,336,568 L29P probably benign Het
Glb1l2 C A 9: 26,806,417 probably benign Het
Gm1110 C G 9: 26,883,280 Q483H probably benign Het
Gm1110 T A 9: 26,883,281 Q483L probably benign Het
Gm5737 T A 7: 120,831,180 V420E possibly damaging Het
Gpc6 T C 14: 116,925,979 L15P probably damaging Het
Hagh C A 17: 24,857,562 S161* probably null Het
Hrh1 A G 6: 114,480,853 D365G probably benign Het
Ighv1-36 A T 12: 114,879,940 M100K probably damaging Het
Itgb8 A T 12: 119,170,778 V518D probably benign Het
Krt82 T C 15: 101,541,803 Y486C probably damaging Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Met A G 6: 17,491,769 S177G probably damaging Het
Myl9 T A 2: 156,781,128 I162N possibly damaging Het
Npat T A 9: 53,566,951 N973K possibly damaging Het
Olfr493 A T 7: 108,346,682 C100S probably damaging Het
Pcdhga12 A T 18: 37,768,137 D674V possibly damaging Het
Phtf1 T A 3: 104,004,449 N702K probably damaging Het
Plaa A T 4: 94,569,477 I752N probably damaging Het
Pnpla2 T C 7: 141,458,098 C194R probably damaging Het
Rnaseh2a T C 8: 84,965,147 N133S probably benign Het
Rps6ka1 T A 4: 133,848,553 Q685L probably benign Het
Ryr1 C A 7: 29,015,717 G4661C unknown Het
Samd13 T A 3: 146,646,402 M65L probably benign Het
Sec22c A G 9: 121,695,655 S21P probably damaging Het
Sh3d19 C A 3: 86,107,022 T431K probably benign Het
Sin3b A G 8: 72,741,480 M277V probably benign Het
Sis T C 3: 72,947,501 T468A possibly damaging Het
Slitrk3 T C 3: 73,049,180 N753S probably benign Het
Slitrk6 C A 14: 110,752,046 L76F probably damaging Het
Stk3 C T 15: 34,876,724 A478T probably damaging Het
Sugp1 C A 8: 70,071,597 Y617* probably null Het
Tinag T C 9: 77,031,695 D167G probably damaging Het
Tk2 A G 8: 104,241,114 probably null Het
Tmem209 A T 6: 30,489,309 V514D probably damaging Het
Tmprss9 A G 10: 80,887,486 H260R probably benign Het
Tnfrsf14 T A 4: 154,926,655 Y83F possibly damaging Het
Tnfrsf8 A T 4: 145,287,983 D285E probably benign Het
Togaram2 C G 17: 71,697,878 A310G probably benign Het
Trpv3 A G 11: 73,291,622 Y544C probably damaging Het
Ttl T A 2: 129,066,184 V13D probably damaging Het
Usp40 A T 1: 87,980,972 D602E probably benign Het
Vamp5 A G 6: 72,370,393 probably benign Het
Vmn2r65 T A 7: 84,940,194 H838L possibly damaging Het
Wdr63 T C 3: 146,097,227 K70E probably damaging Het
Zfp960 T A 17: 17,088,199 Y392N probably benign Het
Other mutations in Fzd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01560:Fzd1 APN 5 4756037 missense probably benign 0.11
R0055:Fzd1 UTSW 5 4756037 missense possibly damaging 0.86
R0055:Fzd1 UTSW 5 4756037 missense possibly damaging 0.86
R0402:Fzd1 UTSW 5 4755702 missense possibly damaging 0.46
R1376:Fzd1 UTSW 5 4757174 missense possibly damaging 0.84
R1376:Fzd1 UTSW 5 4757174 missense possibly damaging 0.84
R1585:Fzd1 UTSW 5 4756278 missense probably damaging 1.00
R1606:Fzd1 UTSW 5 4757514 nonsense probably null
R1708:Fzd1 UTSW 5 4755791 missense possibly damaging 0.82
R1767:Fzd1 UTSW 5 4756812 missense probably benign
R1803:Fzd1 UTSW 5 4756385 missense probably damaging 0.97
R1909:Fzd1 UTSW 5 4757481 missense probably benign 0.01
R2990:Fzd1 UTSW 5 4755758 missense probably damaging 0.98
R4446:Fzd1 UTSW 5 4755777 missense probably damaging 1.00
R4631:Fzd1 UTSW 5 4755865 nonsense probably null
R4632:Fzd1 UTSW 5 4755865 nonsense probably null
R4633:Fzd1 UTSW 5 4755865 nonsense probably null
R5110:Fzd1 UTSW 5 4756448 missense probably benign 0.00
R6406:Fzd1 UTSW 5 4756089 missense probably damaging 1.00
R6489:Fzd1 UTSW 5 4757336 missense probably benign 0.33
R6642:Fzd1 UTSW 5 4755696 missense probably damaging 1.00
R7095:Fzd1 UTSW 5 4755824 small deletion probably benign
R7150:Fzd1 UTSW 5 4756145 missense probably benign 0.14
R7204:Fzd1 UTSW 5 4755980 missense probably damaging 1.00
R8290:Fzd1 UTSW 5 4757060 missense possibly damaging 0.90
R8354:Fzd1 UTSW 5 4757336 missense probably benign 0.18
X0028:Fzd1 UTSW 5 4756958 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAAGAACTTGAGCTCGG -3'
(R):5'- CTTGGAACTTTGTGCCGAAGC -3'

Sequencing Primer
(F):5'- AGGGTAGAACTGGTGCACCTC -3'
(R):5'- TGCCGAAGCACTCCCGG -3'
Posted On2020-10-20