Incidental Mutation 'R8454:Hrh1'
ID654925
Institutional Source Beutler Lab
Gene Symbol Hrh1
Ensembl Gene ENSMUSG00000053004
Gene Namehistamine receptor H1
SynonymsHir, Bphs
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8454 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location114397936-114483296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114480853 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 365 (D365G)
Ref Sequence ENSEMBL: ENSMUSP00000086383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088987] [ENSMUST00000160212] [ENSMUST00000160780] [ENSMUST00000161220] [ENSMUST00000161650]
Predicted Effect probably benign
Transcript: ENSMUST00000088987
AA Change: D365G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000086383
Gene: ENSMUSG00000053004
AA Change: D365G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 1.1e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160212
Predicted Effect probably benign
Transcript: ENSMUST00000160780
AA Change: D365G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124320
Gene: ENSMUSG00000053004
AA Change: D365G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 3.3e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161220
AA Change: D365G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124037
Gene: ENSMUSG00000053004
AA Change: D365G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 1.1e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161650
AA Change: D365G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124460
Gene: ENSMUSG00000053004
AA Change: D365G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 228 2.4e-6 PFAM
Pfam:7tm_1 44 469 1.1e-72 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. The protein encoded by this gene is an integral membrane protein and belongs to the G protein-coupled receptor superfamily. It mediates the contraction of smooth muscles, the increase in capillary permeability due to contraction of terminal venules, the release of catecholamine from adrenal medulla, and neurotransmission in the central nervous system. It has been associated with multiple processes, including memory and learning, circadian rhythm, and thermoregulation. It is also known to contribute to the pathophysiology of allergic diseases such as atopic dermatitis, asthma, anaphylaxis and allergic rhinitis. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous null mutants show decrease in exploratory behavior, diurnal activity, aggression, anxiety, serotonin release, respiratory reaction to temperature and leptin response. Natural variants affect B. pertussis induced vasoactive amine sensitization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,792,572 F493Y probably benign Het
Abcc10 C A 17: 46,324,177 G300V possibly damaging Het
Adgrg7 C G 16: 56,795,682 probably benign Het
Agt G A 8: 124,564,103 T155M probably benign Het
Atp8b3 A G 10: 80,525,799 V763A probably benign Het
Btn1a1 C A 13: 23,464,250 V138L probably benign Het
Cd163 A T 6: 124,328,965 N1109I probably benign Het
Cideb T A 14: 55,755,141 Q106L possibly damaging Het
Cntn1 A G 15: 92,232,249 T126A probably benign Het
Dusp27 A T 1: 166,108,133 N165K probably damaging Het
Elfn1 T C 5: 139,971,471 Y77H probably damaging Het
Eml3 A G 19: 8,934,994 H386R probably damaging Het
Fbxo21 A G 5: 117,995,414 D413G probably damaging Het
Fkbp8 T A 8: 70,531,763 probably null Het
Fzd1 T C 5: 4,757,336 Q82R probably benign Het
Gast T C 11: 100,336,568 L29P probably benign Het
Glb1l2 C A 9: 26,806,417 probably benign Het
Gm1110 C G 9: 26,883,280 Q483H probably benign Het
Gm1110 T A 9: 26,883,281 Q483L probably benign Het
Gm5737 T A 7: 120,831,180 V420E possibly damaging Het
Gpc6 T C 14: 116,925,979 L15P probably damaging Het
Hagh C A 17: 24,857,562 S161* probably null Het
Ighv1-36 A T 12: 114,879,940 M100K probably damaging Het
Itgb8 A T 12: 119,170,778 V518D probably benign Het
Krt82 T C 15: 101,541,803 Y486C probably damaging Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Met A G 6: 17,491,769 S177G probably damaging Het
Myl9 T A 2: 156,781,128 I162N possibly damaging Het
Npat T A 9: 53,566,951 N973K possibly damaging Het
Olfr493 A T 7: 108,346,682 C100S probably damaging Het
Pcdhga12 A T 18: 37,768,137 D674V possibly damaging Het
Phtf1 T A 3: 104,004,449 N702K probably damaging Het
Plaa A T 4: 94,569,477 I752N probably damaging Het
Pnpla2 T C 7: 141,458,098 C194R probably damaging Het
Rnaseh2a T C 8: 84,965,147 N133S probably benign Het
Rps6ka1 T A 4: 133,848,553 Q685L probably benign Het
Ryr1 C A 7: 29,015,717 G4661C unknown Het
Samd13 T A 3: 146,646,402 M65L probably benign Het
Sec22c A G 9: 121,695,655 S21P probably damaging Het
Sh3d19 C A 3: 86,107,022 T431K probably benign Het
Sin3b A G 8: 72,741,480 M277V probably benign Het
Sis T C 3: 72,947,501 T468A possibly damaging Het
Slitrk3 T C 3: 73,049,180 N753S probably benign Het
Slitrk6 C A 14: 110,752,046 L76F probably damaging Het
Stk3 C T 15: 34,876,724 A478T probably damaging Het
Sugp1 C A 8: 70,071,597 Y617* probably null Het
Tinag T C 9: 77,031,695 D167G probably damaging Het
Tk2 A G 8: 104,241,114 probably null Het
Tmem209 A T 6: 30,489,309 V514D probably damaging Het
Tmprss9 A G 10: 80,887,486 H260R probably benign Het
Tnfrsf14 T A 4: 154,926,655 Y83F possibly damaging Het
Tnfrsf8 A T 4: 145,287,983 D285E probably benign Het
Togaram2 C G 17: 71,697,878 A310G probably benign Het
Trpv3 A G 11: 73,291,622 Y544C probably damaging Het
Ttl T A 2: 129,066,184 V13D probably damaging Het
Usp40 A T 1: 87,980,972 D602E probably benign Het
Vamp5 A G 6: 72,370,393 probably benign Het
Vmn2r65 T A 7: 84,940,194 H838L possibly damaging Het
Wdr63 T C 3: 146,097,227 K70E probably damaging Het
Zfp960 T A 17: 17,088,199 Y392N probably benign Het
Other mutations in Hrh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Hrh1 APN 6 114480322 missense probably damaging 0.99
IGL01372:Hrh1 APN 6 114479997 missense probably damaging 1.00
IGL01453:Hrh1 APN 6 114481162 missense probably damaging 1.00
IGL01519:Hrh1 APN 6 114480301 missense probably damaging 1.00
IGL02142:Hrh1 APN 6 114480243 missense probably damaging 1.00
IGL02352:Hrh1 APN 6 114480443 missense probably benign 0.43
IGL02359:Hrh1 APN 6 114480443 missense probably benign 0.43
FR4737:Hrh1 UTSW 6 114481123 missense possibly damaging 0.95
R0335:Hrh1 UTSW 6 114480232 missense probably damaging 1.00
R0635:Hrh1 UTSW 6 114480145 missense probably damaging 1.00
R1493:Hrh1 UTSW 6 114480877 missense probably damaging 0.98
R2283:Hrh1 UTSW 6 114480439 missense probably benign 0.00
R3870:Hrh1 UTSW 6 114480919 missense probably damaging 1.00
R4124:Hrh1 UTSW 6 114480619 missense probably benign 0.06
R4254:Hrh1 UTSW 6 114480001 missense probably damaging 1.00
R4764:Hrh1 UTSW 6 114480535 missense probably benign 0.00
R5270:Hrh1 UTSW 6 114481218 missense possibly damaging 0.75
R6189:Hrh1 UTSW 6 114479998 missense probably damaging 1.00
R6482:Hrh1 UTSW 6 114480763 missense possibly damaging 0.93
R7495:Hrh1 UTSW 6 114480673 missense probably benign 0.05
R7683:Hrh1 UTSW 6 114479787 missense probably benign
R8041:Hrh1 UTSW 6 114479917 missense not run
R8131:Hrh1 UTSW 6 114480292 missense probably benign 0.10
R8354:Hrh1 UTSW 6 114480853 missense probably benign 0.05
R8502:Hrh1 UTSW 6 114481005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGTCTTCAGCCAAGAGG -3'
(R):5'- TACAACCCAACTGCTTGGC -3'

Sequencing Primer
(F):5'- CGTCTTGACGTCATGCAGAC -3'
(R):5'- AACTGCTTGGCTGCCTTC -3'
Posted On2020-10-20