Incidental Mutation 'R8454:Olfr493'
ID654929
Institutional Source Beutler Lab
Gene Symbol Olfr493
Ensembl Gene ENSMUSG00000093980
Gene Nameolfactory receptor 493
SynonymsMOR204-35, GA_x6K02T2PBJ9-10676998-10676054
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R8454 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location108346035-108346979 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108346682 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 100 (C100S)
Ref Sequence ENSEMBL: ENSMUSP00000079005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080106]
Predicted Effect probably damaging
Transcript: ENSMUST00000080106
AA Change: C100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079005
Gene: ENSMUSG00000093980
AA Change: C100S

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 7.1e-55 PFAM
Pfam:7tm_1 44 293 1.1e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,792,572 F493Y probably benign Het
Abcc10 C A 17: 46,324,177 G300V possibly damaging Het
Adgrg7 C G 16: 56,795,682 probably benign Het
Agt G A 8: 124,564,103 T155M probably benign Het
Atp8b3 A G 10: 80,525,799 V763A probably benign Het
Btn1a1 C A 13: 23,464,250 V138L probably benign Het
Cd163 A T 6: 124,328,965 N1109I probably benign Het
Cideb T A 14: 55,755,141 Q106L possibly damaging Het
Cntn1 A G 15: 92,232,249 T126A probably benign Het
Dusp27 A T 1: 166,108,133 N165K probably damaging Het
Elfn1 T C 5: 139,971,471 Y77H probably damaging Het
Eml3 A G 19: 8,934,994 H386R probably damaging Het
Fbxo21 A G 5: 117,995,414 D413G probably damaging Het
Fkbp8 T A 8: 70,531,763 probably null Het
Fzd1 T C 5: 4,757,336 Q82R probably benign Het
Gast T C 11: 100,336,568 L29P probably benign Het
Glb1l2 C A 9: 26,806,417 probably benign Het
Gm1110 C G 9: 26,883,280 Q483H probably benign Het
Gm1110 T A 9: 26,883,281 Q483L probably benign Het
Gm5737 T A 7: 120,831,180 V420E possibly damaging Het
Gpc6 T C 14: 116,925,979 L15P probably damaging Het
Hagh C A 17: 24,857,562 S161* probably null Het
Hrh1 A G 6: 114,480,853 D365G probably benign Het
Ighv1-36 A T 12: 114,879,940 M100K probably damaging Het
Itgb8 A T 12: 119,170,778 V518D probably benign Het
Krt82 T C 15: 101,541,803 Y486C probably damaging Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Met A G 6: 17,491,769 S177G probably damaging Het
Myl9 T A 2: 156,781,128 I162N possibly damaging Het
Npat T A 9: 53,566,951 N973K possibly damaging Het
Pcdhga12 A T 18: 37,768,137 D674V possibly damaging Het
Phtf1 T A 3: 104,004,449 N702K probably damaging Het
Plaa A T 4: 94,569,477 I752N probably damaging Het
Pnpla2 T C 7: 141,458,098 C194R probably damaging Het
Rnaseh2a T C 8: 84,965,147 N133S probably benign Het
Rps6ka1 T A 4: 133,848,553 Q685L probably benign Het
Ryr1 C A 7: 29,015,717 G4661C unknown Het
Samd13 T A 3: 146,646,402 M65L probably benign Het
Sec22c A G 9: 121,695,655 S21P probably damaging Het
Sh3d19 C A 3: 86,107,022 T431K probably benign Het
Sin3b A G 8: 72,741,480 M277V probably benign Het
Sis T C 3: 72,947,501 T468A possibly damaging Het
Slitrk3 T C 3: 73,049,180 N753S probably benign Het
Slitrk6 C A 14: 110,752,046 L76F probably damaging Het
Stk3 C T 15: 34,876,724 A478T probably damaging Het
Sugp1 C A 8: 70,071,597 Y617* probably null Het
Tinag T C 9: 77,031,695 D167G probably damaging Het
Tk2 A G 8: 104,241,114 probably null Het
Tmem209 A T 6: 30,489,309 V514D probably damaging Het
Tmprss9 A G 10: 80,887,486 H260R probably benign Het
Tnfrsf14 T A 4: 154,926,655 Y83F possibly damaging Het
Tnfrsf8 A T 4: 145,287,983 D285E probably benign Het
Togaram2 C G 17: 71,697,878 A310G probably benign Het
Trpv3 A G 11: 73,291,622 Y544C probably damaging Het
Ttl T A 2: 129,066,184 V13D probably damaging Het
Usp40 A T 1: 87,980,972 D602E probably benign Het
Vamp5 A G 6: 72,370,393 probably benign Het
Vmn2r65 T A 7: 84,940,194 H838L possibly damaging Het
Wdr63 T C 3: 146,097,227 K70E probably damaging Het
Zfp960 T A 17: 17,088,199 Y392N probably benign Het
Other mutations in Olfr493
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Olfr493 APN 7 108346949 missense probably benign 0.00
IGL02087:Olfr493 APN 7 108346966 missense probably benign
IGL02484:Olfr493 APN 7 108346606 missense probably damaging 1.00
IGL02961:Olfr493 APN 7 108346127 missense probably benign 0.08
IGL03379:Olfr493 APN 7 108346989 unclassified probably benign
PIT4486001:Olfr493 UTSW 7 108346322 missense possibly damaging 0.95
R0281:Olfr493 UTSW 7 108346914 missense probably benign 0.00
R0285:Olfr493 UTSW 7 108346499 missense probably benign 0.02
R1222:Olfr493 UTSW 7 108346106 missense probably damaging 1.00
R1912:Olfr493 UTSW 7 108346807 missense probably damaging 0.98
R4178:Olfr493 UTSW 7 108346558 missense probably benign 0.00
R5239:Olfr493 UTSW 7 108346646 missense probably benign 0.03
R5421:Olfr493 UTSW 7 108346975 missense probably benign 0.00
R5452:Olfr493 UTSW 7 108346105 missense probably damaging 1.00
R6991:Olfr493 UTSW 7 108346088 missense possibly damaging 0.92
R7372:Olfr493 UTSW 7 108346496 missense probably benign 0.00
R7374:Olfr493 UTSW 7 108346888 missense probably damaging 1.00
R7571:Olfr493 UTSW 7 108346482 missense probably benign 0.00
R8232:Olfr493 UTSW 7 108346288 missense probably damaging 0.97
R8354:Olfr493 UTSW 7 108346682 missense probably damaging 1.00
X0025:Olfr493 UTSW 7 108346601 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGTTACCACTTCAGAGACACTG -3'
(R):5'- TCCTGTGCATCTACCTGGTG -3'

Sequencing Primer
(F):5'- GATTCTATTTGGTCCACAGAAGAG -3'
(R):5'- GCATCTACCTGGTGACTGTGTC -3'
Posted On2020-10-20