Incidental Mutation 'R8454:Pnpla2'
ID654932
Institutional Source Beutler Lab
Gene Symbol Pnpla2
Ensembl Gene ENSMUSG00000025509
Gene Namepatatin-like phospholipase domain containing 2
SynonymsAtgl, 0610039C21Rik, 1110001C14Rik, desnutrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.483) question?
Stock #R8454 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location141455198-141460743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141458098 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 194 (C194R)
Ref Sequence ENSEMBL: ENSMUSP00000127149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026583] [ENSMUST00000053670] [ENSMUST00000064151] [ENSMUST00000164016] [ENSMUST00000164924] [ENSMUST00000165194] [ENSMUST00000165487] [ENSMUST00000167491] [ENSMUST00000169665]
Predicted Effect probably benign
Transcript: ENSMUST00000026583
SMART Domains Protein: ENSMUSP00000026583
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 69 4.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053670
SMART Domains Protein: ENSMUSP00000055899
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 312 N/A INTRINSIC
low complexity region 324 346 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000064151
AA Change: C194R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065116
Gene: ENSMUSG00000025509
AA Change: C194R

DomainStartEndE-ValueType
Pfam:Patatin 10 179 1.8e-15 PFAM
low complexity region 409 425 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164016
AA Change: C194R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127149
Gene: ENSMUSG00000025509
AA Change: C194R

DomainStartEndE-ValueType
Pfam:Patatin 10 179 3.3e-15 PFAM
low complexity region 243 287 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164924
SMART Domains Protein: ENSMUSP00000129632
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 69 4.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165194
Predicted Effect probably damaging
Transcript: ENSMUST00000165487
AA Change: C141R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000167491
SMART Domains Protein: ENSMUSP00000127957
Gene: ENSMUSG00000048200

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
EFh 32 60 2.71e0 SMART
EFh 66 94 2.63e0 SMART
low complexity region 108 126 N/A INTRINSIC
coiled coil region 167 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169665
SMART Domains Protein: ENSMUSP00000127983
Gene: ENSMUSG00000025509

DomainStartEndE-ValueType
Pfam:Patatin 10 249 3.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes the first step in the hydrolysis of triglycerides in adipose tissue. Mutations in this gene are associated with neutral lipid storage disease with myopathy. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for this targeted mutation have defects in lipolysis and altered energy metabolism. Triglyceride accumulation in cardiac muscle leads to severe cardiac dysfunction and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,792,572 F493Y probably benign Het
Abcc10 C A 17: 46,324,177 G300V possibly damaging Het
Adgrg7 C G 16: 56,795,682 probably benign Het
Agt G A 8: 124,564,103 T155M probably benign Het
Atp8b3 A G 10: 80,525,799 V763A probably benign Het
Btn1a1 C A 13: 23,464,250 V138L probably benign Het
Cd163 A T 6: 124,328,965 N1109I probably benign Het
Cideb T A 14: 55,755,141 Q106L possibly damaging Het
Cntn1 A G 15: 92,232,249 T126A probably benign Het
Dusp27 A T 1: 166,108,133 N165K probably damaging Het
Elfn1 T C 5: 139,971,471 Y77H probably damaging Het
Eml3 A G 19: 8,934,994 H386R probably damaging Het
Fbxo21 A G 5: 117,995,414 D413G probably damaging Het
Fkbp8 T A 8: 70,531,763 probably null Het
Fzd1 T C 5: 4,757,336 Q82R probably benign Het
Gast T C 11: 100,336,568 L29P probably benign Het
Glb1l2 C A 9: 26,806,417 probably benign Het
Gm1110 C G 9: 26,883,280 Q483H probably benign Het
Gm1110 T A 9: 26,883,281 Q483L probably benign Het
Gm5737 T A 7: 120,831,180 V420E possibly damaging Het
Gpc6 T C 14: 116,925,979 L15P probably damaging Het
Hagh C A 17: 24,857,562 S161* probably null Het
Hrh1 A G 6: 114,480,853 D365G probably benign Het
Ighv1-36 A T 12: 114,879,940 M100K probably damaging Het
Itgb8 A T 12: 119,170,778 V518D probably benign Het
Krt82 T C 15: 101,541,803 Y486C probably damaging Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Met A G 6: 17,491,769 S177G probably damaging Het
Myl9 T A 2: 156,781,128 I162N possibly damaging Het
Npat T A 9: 53,566,951 N973K possibly damaging Het
Olfr493 A T 7: 108,346,682 C100S probably damaging Het
Pcdhga12 A T 18: 37,768,137 D674V possibly damaging Het
Phtf1 T A 3: 104,004,449 N702K probably damaging Het
Plaa A T 4: 94,569,477 I752N probably damaging Het
Rnaseh2a T C 8: 84,965,147 N133S probably benign Het
Rps6ka1 T A 4: 133,848,553 Q685L probably benign Het
Ryr1 C A 7: 29,015,717 G4661C unknown Het
Samd13 T A 3: 146,646,402 M65L probably benign Het
Sec22c A G 9: 121,695,655 S21P probably damaging Het
Sh3d19 C A 3: 86,107,022 T431K probably benign Het
Sin3b A G 8: 72,741,480 M277V probably benign Het
Sis T C 3: 72,947,501 T468A possibly damaging Het
Slitrk3 T C 3: 73,049,180 N753S probably benign Het
Slitrk6 C A 14: 110,752,046 L76F probably damaging Het
Stk3 C T 15: 34,876,724 A478T probably damaging Het
Sugp1 C A 8: 70,071,597 Y617* probably null Het
Tinag T C 9: 77,031,695 D167G probably damaging Het
Tk2 A G 8: 104,241,114 probably null Het
Tmem209 A T 6: 30,489,309 V514D probably damaging Het
Tmprss9 A G 10: 80,887,486 H260R probably benign Het
Tnfrsf14 T A 4: 154,926,655 Y83F possibly damaging Het
Tnfrsf8 A T 4: 145,287,983 D285E probably benign Het
Togaram2 C G 17: 71,697,878 A310G probably benign Het
Trpv3 A G 11: 73,291,622 Y544C probably damaging Het
Ttl T A 2: 129,066,184 V13D probably damaging Het
Usp40 A T 1: 87,980,972 D602E probably benign Het
Vamp5 A G 6: 72,370,393 probably benign Het
Vmn2r65 T A 7: 84,940,194 H838L possibly damaging Het
Wdr63 T C 3: 146,097,227 K70E probably damaging Het
Zfp960 T A 17: 17,088,199 Y392N probably benign Het
Other mutations in Pnpla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02267:Pnpla2 APN 7 141458209 missense probably damaging 1.00
IGL02622:Pnpla2 APN 7 141455372 missense probably damaging 1.00
R0334:Pnpla2 UTSW 7 141459520 splice site probably null
R1145:Pnpla2 UTSW 7 141455416 missense probably damaging 1.00
R1145:Pnpla2 UTSW 7 141455416 missense probably damaging 1.00
R1171:Pnpla2 UTSW 7 141458881 missense probably benign 0.05
R1435:Pnpla2 UTSW 7 141457411 missense probably benign 0.00
R1774:Pnpla2 UTSW 7 141459568 missense probably damaging 0.96
R1866:Pnpla2 UTSW 7 141455416 missense probably damaging 1.00
R1967:Pnpla2 UTSW 7 141459432 missense probably benign 0.21
R2153:Pnpla2 UTSW 7 141459219 missense probably damaging 1.00
R2443:Pnpla2 UTSW 7 141458069 missense possibly damaging 0.73
R2923:Pnpla2 UTSW 7 141455467 missense probably benign 0.15
R2964:Pnpla2 UTSW 7 141458478 missense probably damaging 1.00
R2966:Pnpla2 UTSW 7 141458478 missense probably damaging 1.00
R4576:Pnpla2 UTSW 7 141457344 missense probably damaging 1.00
R4577:Pnpla2 UTSW 7 141457344 missense probably damaging 1.00
R4646:Pnpla2 UTSW 7 141458661 missense possibly damaging 0.69
R4677:Pnpla2 UTSW 7 141458443 missense probably damaging 1.00
R4934:Pnpla2 UTSW 7 141458172 missense probably damaging 1.00
R5011:Pnpla2 UTSW 7 141459291 critical splice donor site probably null
R5334:Pnpla2 UTSW 7 141459493 missense probably damaging 0.97
R6331:Pnpla2 UTSW 7 141459285 missense probably damaging 0.99
R7361:Pnpla2 UTSW 7 141457431 missense possibly damaging 0.77
R7959:Pnpla2 UTSW 7 141457493 missense probably benign 0.00
R8066:Pnpla2 UTSW 7 141459668 makesense probably null
R8354:Pnpla2 UTSW 7 141458098 missense probably damaging 1.00
X0020:Pnpla2 UTSW 7 141459660 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTCAAGTGGAACCGAGTAG -3'
(R):5'- TTGAAGTCCTGCCAACCTTG -3'

Sequencing Primer
(F):5'- AGTAGGGCTGCCAGGACAC -3'
(R):5'- TGTCATCCCAGGGCTCAGAG -3'
Posted On2020-10-20