Incidental Mutation 'R8454:Fkbp8'
ID654934
Institutional Source Beutler Lab
Gene Symbol Fkbp8
Ensembl Gene ENSMUSG00000019428
Gene NameFK506 binding protein 8
Synonyms38kDa, Fkbp38
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8454 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location70527724-70535328 bp(+) (GRCm38)
Type of Mutationsplice site (21 bp from exon)
DNA Base Change (assembly) T to A at 70531763 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075491] [ENSMUST00000117580] [ENSMUST00000119353] [ENSMUST00000119425] [ENSMUST00000119698] [ENSMUST00000132867] [ENSMUST00000134893] [ENSMUST00000138260]
Predicted Effect probably null
Transcript: ENSMUST00000075491
SMART Domains Protein: ENSMUSP00000074935
Gene: ENSMUSG00000019428

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
Pfam:FKBP_C 103 192 1.4e-16 PFAM
Blast:TPR 212 245 2e-12 BLAST
low complexity region 253 259 N/A INTRINSIC
Pfam:TPR_1 263 296 5.4e-7 PFAM
Pfam:TPR_2 263 296 3.8e-5 PFAM
Pfam:TPR_16 267 331 3e-11 PFAM
Pfam:TPR_9 270 344 1.3e-7 PFAM
Pfam:TPR_19 273 340 1.6e-8 PFAM
Pfam:TPR_1 297 330 5.4e-8 PFAM
Pfam:TPR_2 297 330 1.3e-7 PFAM
Pfam:TPR_8 297 330 9e-7 PFAM
Pfam:TPR_14 297 340 2.1e-7 PFAM
transmembrane domain 381 400 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117580
SMART Domains Protein: ENSMUSP00000112561
Gene: ENSMUSG00000055553

DomainStartEndE-ValueType
Pfam:KxDL 12 99 5.1e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119353
SMART Domains Protein: ENSMUSP00000112527
Gene: ENSMUSG00000019428

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
Pfam:FKBP_C 103 191 1.3e-15 PFAM
Pfam:TPR_11 209 293 3.4e-9 PFAM
Pfam:TPR_1 262 295 6.5e-7 PFAM
Pfam:TPR_2 262 295 3.9e-5 PFAM
Pfam:TPR_16 266 330 1.4e-11 PFAM
Pfam:TPR_9 269 343 1.5e-7 PFAM
Pfam:TPR_19 272 339 8.6e-9 PFAM
Pfam:TPR_11 294 358 2.6e-9 PFAM
Pfam:TPR_1 296 329 6.6e-8 PFAM
Pfam:TPR_2 296 329 1.3e-7 PFAM
Pfam:TPR_8 296 330 5.5e-7 PFAM
transmembrane domain 380 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119425
SMART Domains Protein: ENSMUSP00000113528
Gene: ENSMUSG00000019428

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119698
SMART Domains Protein: ENSMUSP00000114069
Gene: ENSMUSG00000019428

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
Pfam:FKBP_C 103 192 6.4e-16 PFAM
Pfam:TPR_11 210 294 3.4e-9 PFAM
Pfam:TPR_1 263 296 6.5e-7 PFAM
Pfam:TPR_2 263 296 3.9e-5 PFAM
Pfam:TPR_16 267 331 1.4e-11 PFAM
Pfam:TPR_9 270 344 1.5e-7 PFAM
Pfam:TPR_19 273 340 8.6e-9 PFAM
Pfam:TPR_11 295 359 2.6e-9 PFAM
Pfam:TPR_1 297 330 6.6e-8 PFAM
Pfam:TPR_2 297 330 1.3e-7 PFAM
Pfam:TPR_8 297 331 5.6e-7 PFAM
transmembrane domain 381 400 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132867
Predicted Effect probably benign
Transcript: ENSMUST00000134893
Predicted Effect probably benign
Transcript: ENSMUST00000138260
SMART Domains Protein: ENSMUSP00000123438
Gene: ENSMUSG00000055553

DomainStartEndE-ValueType
Pfam:KxDL 12 99 9.2e-40 PFAM
UBQ 105 176 2.14e-36 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. Unlike the other members of the family, this encoded protein does not seem to have PPIase/rotamase activity. It may have a role in neurons associated with memory function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality, ventralization of neural cell fates, caudal neural tube dilation, and small eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,792,572 F493Y probably benign Het
Abcc10 C A 17: 46,324,177 G300V possibly damaging Het
Adgrg7 C G 16: 56,795,682 probably benign Het
Agt G A 8: 124,564,103 T155M probably benign Het
Atp8b3 A G 10: 80,525,799 V763A probably benign Het
Btn1a1 C A 13: 23,464,250 V138L probably benign Het
Cd163 A T 6: 124,328,965 N1109I probably benign Het
Cideb T A 14: 55,755,141 Q106L possibly damaging Het
Cntn1 A G 15: 92,232,249 T126A probably benign Het
Dusp27 A T 1: 166,108,133 N165K probably damaging Het
Elfn1 T C 5: 139,971,471 Y77H probably damaging Het
Eml3 A G 19: 8,934,994 H386R probably damaging Het
Fbxo21 A G 5: 117,995,414 D413G probably damaging Het
Fzd1 T C 5: 4,757,336 Q82R probably benign Het
Gast T C 11: 100,336,568 L29P probably benign Het
Glb1l2 C A 9: 26,806,417 probably benign Het
Gm1110 C G 9: 26,883,280 Q483H probably benign Het
Gm1110 T A 9: 26,883,281 Q483L probably benign Het
Gm5737 T A 7: 120,831,180 V420E possibly damaging Het
Gpc6 T C 14: 116,925,979 L15P probably damaging Het
Hagh C A 17: 24,857,562 S161* probably null Het
Hrh1 A G 6: 114,480,853 D365G probably benign Het
Ighv1-36 A T 12: 114,879,940 M100K probably damaging Het
Itgb8 A T 12: 119,170,778 V518D probably benign Het
Krt82 T C 15: 101,541,803 Y486C probably damaging Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Met A G 6: 17,491,769 S177G probably damaging Het
Myl9 T A 2: 156,781,128 I162N possibly damaging Het
Npat T A 9: 53,566,951 N973K possibly damaging Het
Olfr493 A T 7: 108,346,682 C100S probably damaging Het
Pcdhga12 A T 18: 37,768,137 D674V possibly damaging Het
Phtf1 T A 3: 104,004,449 N702K probably damaging Het
Plaa A T 4: 94,569,477 I752N probably damaging Het
Pnpla2 T C 7: 141,458,098 C194R probably damaging Het
Rnaseh2a T C 8: 84,965,147 N133S probably benign Het
Rps6ka1 T A 4: 133,848,553 Q685L probably benign Het
Ryr1 C A 7: 29,015,717 G4661C unknown Het
Samd13 T A 3: 146,646,402 M65L probably benign Het
Sec22c A G 9: 121,695,655 S21P probably damaging Het
Sh3d19 C A 3: 86,107,022 T431K probably benign Het
Sin3b A G 8: 72,741,480 M277V probably benign Het
Sis T C 3: 72,947,501 T468A possibly damaging Het
Slitrk3 T C 3: 73,049,180 N753S probably benign Het
Slitrk6 C A 14: 110,752,046 L76F probably damaging Het
Stk3 C T 15: 34,876,724 A478T probably damaging Het
Sugp1 C A 8: 70,071,597 Y617* probably null Het
Tinag T C 9: 77,031,695 D167G probably damaging Het
Tk2 A G 8: 104,241,114 probably null Het
Tmem209 A T 6: 30,489,309 V514D probably damaging Het
Tmprss9 A G 10: 80,887,486 H260R probably benign Het
Tnfrsf14 T A 4: 154,926,655 Y83F possibly damaging Het
Tnfrsf8 A T 4: 145,287,983 D285E probably benign Het
Togaram2 C G 17: 71,697,878 A310G probably benign Het
Trpv3 A G 11: 73,291,622 Y544C probably damaging Het
Ttl T A 2: 129,066,184 V13D probably damaging Het
Usp40 A T 1: 87,980,972 D602E probably benign Het
Vamp5 A G 6: 72,370,393 probably benign Het
Vmn2r65 T A 7: 84,940,194 H838L possibly damaging Het
Wdr63 T C 3: 146,097,227 K70E probably damaging Het
Zfp960 T A 17: 17,088,199 Y392N probably benign Het
Other mutations in Fkbp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Fkbp8 APN 8 70534561 missense probably damaging 1.00
IGL01832:Fkbp8 APN 8 70531545 missense probably benign 0.24
R0738:Fkbp8 UTSW 8 70529670 missense probably damaging 1.00
R1631:Fkbp8 UTSW 8 70531632 missense probably damaging 1.00
R1845:Fkbp8 UTSW 8 70531035 splice site probably null
R3951:Fkbp8 UTSW 8 70532661 missense probably damaging 1.00
R3953:Fkbp8 UTSW 8 70534867 missense probably damaging 0.97
R3956:Fkbp8 UTSW 8 70534867 missense probably damaging 0.97
R3957:Fkbp8 UTSW 8 70534867 missense probably damaging 0.97
R4965:Fkbp8 UTSW 8 70531523 critical splice acceptor site probably null
R6655:Fkbp8 UTSW 8 70532670 missense probably damaging 1.00
R7081:Fkbp8 UTSW 8 70530994 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGAAGTCACCCTGAAGACG -3'
(R):5'- GGAATATTCTAGAACGTTCTATGGC -3'

Sequencing Primer
(F):5'- TCACCCTGAAGACGGCAGAG -3'
(R):5'- GAACGTTCTATGGCCCAAATG -3'
Posted On2020-10-20