Incidental Mutation 'R8454:Rnaseh2a'
ID654936
Institutional Source Beutler Lab
Gene Symbol Rnaseh2a
Ensembl Gene ENSMUSG00000052926
Gene Nameribonuclease H2, large subunit
Synonyms2400006P09Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_027187.3; MGI: 1916974

Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R8454 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location84956610-84969767 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84965147 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 133 (N133S)
Ref Sequence ENSEMBL: ENSMUSP00000105360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005292] [ENSMUST00000065049] [ENSMUST00000109733] [ENSMUST00000109734] [ENSMUST00000109736] [ENSMUST00000109738] [ENSMUST00000125893] [ENSMUST00000128972] [ENSMUST00000130902] [ENSMUST00000140561] [ENSMUST00000147812] [ENSMUST00000214133]
Predicted Effect probably benign
Transcript: ENSMUST00000005292
SMART Domains Protein: ENSMUSP00000005292
Gene: ENSMUSG00000005161

DomainStartEndE-ValueType
Pfam:Redoxin 7 157 3.9e-20 PFAM
Pfam:AhpC-TSA 8 141 5.6e-44 PFAM
Pfam:1-cysPrx_C 161 196 8.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065049
AA Change: N133S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066769
Gene: ENSMUSG00000052926
AA Change: N133S

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 7.1e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109733
SMART Domains Protein: ENSMUSP00000105355
Gene: ENSMUSG00000005161

DomainStartEndE-ValueType
Pfam:Redoxin 7 159 1.3e-21 PFAM
Pfam:AhpC-TSA 8 141 1.3e-44 PFAM
Pfam:1-cysPrx_C 161 196 8.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109734
SMART Domains Protein: ENSMUSP00000105356
Gene: ENSMUSG00000005161

DomainStartEndE-ValueType
Pfam:Redoxin 7 159 1.3e-21 PFAM
Pfam:AhpC-TSA 8 141 1.3e-44 PFAM
Pfam:1-cysPrx_C 161 196 8.6e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109736
AA Change: N133S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105358
Gene: ENSMUSG00000052926
AA Change: N133S

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109738
AA Change: N133S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105360
Gene: ENSMUSG00000052926
AA Change: N133S

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 5.5e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125893
SMART Domains Protein: ENSMUSP00000122694
Gene: ENSMUSG00000005161

DomainStartEndE-ValueType
Pfam:Redoxin 7 147 1.4e-21 PFAM
Pfam:AhpC-TSA 8 141 2.3e-45 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000121864
Gene: ENSMUSG00000052926
AA Change: N133S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:RNase_HII 57 268 1.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130902
Predicted Effect probably benign
Transcript: ENSMUST00000140561
SMART Domains Protein: ENSMUSP00000118442
Gene: ENSMUSG00000052926

DomainStartEndE-ValueType
Pfam:RNase_HII 31 54 4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147812
AA Change: N133S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120374
Gene: ENSMUSG00000052926
AA Change: N133S

DomainStartEndE-ValueType
Pfam:RNase_HII 31 242 1.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214133
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the heterotrimeric type II ribonuclease H enzyme (RNAseH2). RNAseH2 is the major source of ribonuclease H activity in mammalian cells and endonucleolytically cleaves ribonucleotides. It is predicted to remove Okazaki fragment RNA primers during lagging strand DNA synthesis and to excise single ribonucleotides from DNA-DNA duplexes. Mutations in this gene cause Aicardi-Goutieres Syndrome (AGS), a an autosomal recessive neurological disorder characterized by progressive microcephaly and psychomotor retardation, intracranial calcifications, elevated levels of interferon-alpha and white blood cells in the cerebrospinal fluid.[provided by RefSeq, Aug 2009]
Allele List at MGI

All alleles(33) : Targeted(1) Gene trapped(32)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,792,572 F493Y probably benign Het
Abcc10 C A 17: 46,324,177 G300V possibly damaging Het
Adgrg7 C G 16: 56,795,682 probably benign Het
Agt G A 8: 124,564,103 T155M probably benign Het
Atp8b3 A G 10: 80,525,799 V763A probably benign Het
Btn1a1 C A 13: 23,464,250 V138L probably benign Het
Cd163 A T 6: 124,328,965 N1109I probably benign Het
Cideb T A 14: 55,755,141 Q106L possibly damaging Het
Cntn1 A G 15: 92,232,249 T126A probably benign Het
Dusp27 A T 1: 166,108,133 N165K probably damaging Het
Elfn1 T C 5: 139,971,471 Y77H probably damaging Het
Eml3 A G 19: 8,934,994 H386R probably damaging Het
Fbxo21 A G 5: 117,995,414 D413G probably damaging Het
Fkbp8 T A 8: 70,531,763 probably null Het
Fzd1 T C 5: 4,757,336 Q82R probably benign Het
Gast T C 11: 100,336,568 L29P probably benign Het
Glb1l2 C A 9: 26,806,417 probably benign Het
Gm1110 C G 9: 26,883,280 Q483H probably benign Het
Gm1110 T A 9: 26,883,281 Q483L probably benign Het
Gm5737 T A 7: 120,831,180 V420E possibly damaging Het
Gpc6 T C 14: 116,925,979 L15P probably damaging Het
Hagh C A 17: 24,857,562 S161* probably null Het
Hrh1 A G 6: 114,480,853 D365G probably benign Het
Ighv1-36 A T 12: 114,879,940 M100K probably damaging Het
Itgb8 A T 12: 119,170,778 V518D probably benign Het
Krt82 T C 15: 101,541,803 Y486C probably damaging Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Met A G 6: 17,491,769 S177G probably damaging Het
Myl9 T A 2: 156,781,128 I162N possibly damaging Het
Npat T A 9: 53,566,951 N973K possibly damaging Het
Olfr493 A T 7: 108,346,682 C100S probably damaging Het
Pcdhga12 A T 18: 37,768,137 D674V possibly damaging Het
Phtf1 T A 3: 104,004,449 N702K probably damaging Het
Plaa A T 4: 94,569,477 I752N probably damaging Het
Pnpla2 T C 7: 141,458,098 C194R probably damaging Het
Rps6ka1 T A 4: 133,848,553 Q685L probably benign Het
Ryr1 C A 7: 29,015,717 G4661C unknown Het
Samd13 T A 3: 146,646,402 M65L probably benign Het
Sec22c A G 9: 121,695,655 S21P probably damaging Het
Sh3d19 C A 3: 86,107,022 T431K probably benign Het
Sin3b A G 8: 72,741,480 M277V probably benign Het
Sis T C 3: 72,947,501 T468A possibly damaging Het
Slitrk3 T C 3: 73,049,180 N753S probably benign Het
Slitrk6 C A 14: 110,752,046 L76F probably damaging Het
Stk3 C T 15: 34,876,724 A478T probably damaging Het
Sugp1 C A 8: 70,071,597 Y617* probably null Het
Tinag T C 9: 77,031,695 D167G probably damaging Het
Tk2 A G 8: 104,241,114 probably null Het
Tmem209 A T 6: 30,489,309 V514D probably damaging Het
Tmprss9 A G 10: 80,887,486 H260R probably benign Het
Tnfrsf14 T A 4: 154,926,655 Y83F possibly damaging Het
Tnfrsf8 A T 4: 145,287,983 D285E probably benign Het
Togaram2 C G 17: 71,697,878 A310G probably benign Het
Trpv3 A G 11: 73,291,622 Y544C probably damaging Het
Ttl T A 2: 129,066,184 V13D probably damaging Het
Usp40 A T 1: 87,980,972 D602E probably benign Het
Vamp5 A G 6: 72,370,393 probably benign Het
Vmn2r65 T A 7: 84,940,194 H838L possibly damaging Het
Wdr63 T C 3: 146,097,227 K70E probably damaging Het
Zfp960 T A 17: 17,088,199 Y392N probably benign Het
Other mutations in Rnaseh2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01318:Rnaseh2a APN 8 84965123 unclassified probably benign
IGL01773:Rnaseh2a APN 8 84965138 missense probably damaging 1.00
IGL02606:Rnaseh2a APN 8 84960094 missense probably damaging 1.00
P0016:Rnaseh2a UTSW 8 84959800 missense probably damaging 1.00
R1521:Rnaseh2a UTSW 8 84965858 critical splice donor site probably null
R2270:Rnaseh2a UTSW 8 84965419 missense probably benign 0.03
R4226:Rnaseh2a UTSW 8 84960073 missense possibly damaging 0.72
R4227:Rnaseh2a UTSW 8 84960073 missense possibly damaging 0.72
R4763:Rnaseh2a UTSW 8 84965392 missense probably benign 0.02
R5344:Rnaseh2a UTSW 8 84958106 unclassified probably benign
R8000:Rnaseh2a UTSW 8 84966049 unclassified probably benign
R8354:Rnaseh2a UTSW 8 84965147 missense probably benign
RF008:Rnaseh2a UTSW 8 84960058 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAACAGGGTTCAGGCTGGA -3'
(R):5'- GAGGCGTCCCTTCATGAG -3'

Sequencing Primer
(F):5'- AGGGTGGCCATAAACTCTTC -3'
(R):5'- CGTCCCTTCATGAGTGGGG -3'
Posted On2020-10-20