Mutagenetix > Incidental Mutations

Incidental Mutation 'R8454:Tinag'

654943

Institutional Source

Beutler Lab

Gene Symbol

Tinag

Ensembl Gene

ENSMUSG00000032357

Gene Name

tubulointerstitial nephritis antigen

Synonyms

TIN-ag

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R8454 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

76951693-77045794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77031695 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 167 (D167G)

Ref Sequence

ENSEMBL: ENSMUSP00000034911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034911
AA Change: D167G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: D167G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART
Pept_C1	216	466	1.83e-52	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000184897
AA Change: D167G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357
AA Change: D167G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	A	7: 118,792,572	F493Y	probably benign	Het
Abcc10	C	A	17: 46,324,177	G300V	possibly damaging	Het
Adgrg7	C	G	16: 56,795,682		probably benign	Het
Agt	G	A	8: 124,564,103	T155M	probably benign	Het
Atp8b3	A	G	10: 80,525,799	V763A	probably benign	Het
Btn1a1	C	A	13: 23,464,250	V138L	probably benign	Het
Cd163	A	T	6: 124,328,965	N1109I	probably benign	Het
Cideb	T	A	14: 55,755,141	Q106L	possibly damaging	Het
Cntn1	A	G	15: 92,232,249	T126A	probably benign	Het
Dusp27	A	T	1: 166,108,133	N165K	probably damaging	Het
Elfn1	T	C	5: 139,971,471	Y77H	probably damaging	Het
Eml3	A	G	19: 8,934,994	H386R	probably damaging	Het
Fbxo21	A	G	5: 117,995,414	D413G	probably damaging	Het
Fkbp8	T	A	8: 70,531,763		probably null	Het
Fzd1	T	C	5: 4,757,336	Q82R	probably benign	Het
Gast	T	C	11: 100,336,568	L29P	probably benign	Het
Glb1l2	C	A	9: 26,806,417		probably benign	Het
Gm1110	C	G	9: 26,883,280	Q483H	probably benign	Het
Gm1110	T	A	9: 26,883,281	Q483L	probably benign	Het
Gm5737	T	A	7: 120,831,180	V420E	possibly damaging	Het
Gpc6	T	C	14: 116,925,979	L15P	probably damaging	Het
Hagh	C	A	17: 24,857,562	S161*	probably null	Het
Hrh1	A	G	6: 114,480,853	D365G	probably benign	Het
Ighv1-36	A	T	12: 114,879,940	M100K	probably damaging	Het
Itgb8	A	T	12: 119,170,778	V518D	probably benign	Het
Krt82	T	C	15: 101,541,803	Y486C	probably damaging	Het
Lmbr1l	A	G	15: 98,912,476	S85P	probably damaging	Het
Met	A	G	6: 17,491,769	S177G	probably damaging	Het
Myl9	T	A	2: 156,781,128	I162N	possibly damaging	Het
Npat	T	A	9: 53,566,951	N973K	possibly damaging	Het
Olfr493	A	T	7: 108,346,682	C100S	probably damaging	Het
Pcdhga12	A	T	18: 37,768,137	D674V	possibly damaging	Het
Phtf1	T	A	3: 104,004,449	N702K	probably damaging	Het
Plaa	A	T	4: 94,569,477	I752N	probably damaging	Het
Pnpla2	T	C	7: 141,458,098	C194R	probably damaging	Het
Rnaseh2a	T	C	8: 84,965,147	N133S	probably benign	Het
Rps6ka1	T	A	4: 133,848,553	Q685L	probably benign	Het
Ryr1	C	A	7: 29,015,717	G4661C	unknown	Het
Samd13	T	A	3: 146,646,402	M65L	probably benign	Het
Sec22c	A	G	9: 121,695,655	S21P	probably damaging	Het
Sh3d19	C	A	3: 86,107,022	T431K	probably benign	Het
Sin3b	A	G	8: 72,741,480	M277V	probably benign	Het
Sis	T	C	3: 72,947,501	T468A	possibly damaging	Het
Slitrk3	T	C	3: 73,049,180	N753S	probably benign	Het
Slitrk6	C	A	14: 110,752,046	L76F	probably damaging	Het
Stk3	C	T	15: 34,876,724	A478T	probably damaging	Het
Sugp1	C	A	8: 70,071,597	Y617*	probably null	Het
Tk2	A	G	8: 104,241,114		probably null	Het
Tmem209	A	T	6: 30,489,309	V514D	probably damaging	Het
Tmprss9	A	G	10: 80,887,486	H260R	probably benign	Het
Tnfrsf14	T	A	4: 154,926,655	Y83F	possibly damaging	Het
Tnfrsf8	A	T	4: 145,287,983	D285E	probably benign	Het
Togaram2	C	G	17: 71,697,878	A310G	probably benign	Het
Trpv3	A	G	11: 73,291,622	Y544C	probably damaging	Het
Ttl	T	A	2: 129,066,184	V13D	probably damaging	Het
Usp40	A	T	1: 87,980,972	D602E	probably benign	Het
Vamp5	A	G	6: 72,370,393		probably benign	Het
Vmn2r65	T	A	7: 84,940,194	H838L	possibly damaging	Het
Wdr63	T	C	3: 146,097,227	K70E	probably damaging	Het
Zfp960	T	A	17: 17,088,199	Y392N	probably benign	Het

Other mutations in Tinag

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01450:Tinag	APN	9	77045576	missense	possibly damaging	0.93
IGL01524:Tinag	APN	9	77045538	missense	probably damaging	1.00
IGL01537:Tinag	APN	9	77045603	missense	probably benign	0.01
IGL01832:Tinag	APN	9	77031756	missense	probably benign	0.18
IGL02512:Tinag	APN	9	77031787	splice site	probably benign
IGL02888:Tinag	APN	9	77031713	missense	probably benign	0.24
R0179:Tinag	UTSW	9	76996882	splice site	probably benign
R0200:Tinag	UTSW	9	76951935	missense	probably damaging	1.00
R0206:Tinag	UTSW	9	76999852	missense	probably damaging	1.00
R0545:Tinag	UTSW	9	77031710	missense	possibly damaging	0.61
R0666:Tinag	UTSW	9	77005687	missense	probably benign	0.02
R0685:Tinag	UTSW	9	76952003	missense	probably damaging	1.00
R0732:Tinag	UTSW	9	77001654	missense	possibly damaging	0.93
R1445:Tinag	UTSW	9	77045516	missense	probably damaging	1.00
R2318:Tinag	UTSW	9	77045411	missense	probably damaging	1.00
R3809:Tinag	UTSW	9	76951905	missense	probably benign	0.15
R4747:Tinag	UTSW	9	76996956	missense	probably benign
R4781:Tinag	UTSW	9	76996950	missense	possibly damaging	0.69
R5110:Tinag	UTSW	9	76952007	missense	probably damaging	1.00
R5328:Tinag	UTSW	9	77005631	nonsense	probably null
R5605:Tinag	UTSW	9	77045412	missense	probably damaging	1.00
R5897:Tinag	UTSW	9	77045444	missense	probably damaging	1.00
R6296:Tinag	UTSW	9	76996935	missense	possibly damaging	0.67
R6822:Tinag	UTSW	9	77031702	missense	probably benign	0.00
R6915:Tinag	UTSW	9	77001615	missense	probably damaging	1.00
R7285:Tinag	UTSW	9	77045661	missense	probably benign
R7334:Tinag	UTSW	9	77001649	missense	probably damaging	1.00
R7974:Tinag	UTSW	9	76999849	missense	probably benign	0.01
R8354:Tinag	UTSW	9	77031695	missense	probably damaging	1.00
Z1177:Tinag	UTSW	9	77045498	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GAAGATTCATTCACTCTCTCACCAC -3'
(R):5'- CAAGCACATTGAGCAGCGTG -3'

Sequencing Primer
(F):5'- ACTCAATGACACAAATCTTTCCTAG -3'
(R):5'- CACATTGAGCAGCGTGTAATAC -3'

Posted On

2020-10-20