Incidental Mutation 'R0385:Tapt1'
ID65495
Institutional Source Beutler Lab
Gene Symbol Tapt1
Ensembl Gene ENSMUSG00000046985
Gene Nametransmembrane anterior posterior transformation 1
Synonyms
MMRRC Submission 038591-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R0385 (G1)
Quality Score134
Status Not validated
Chromosome5
Chromosomal Location44175154-44226626 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 44218101 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000062110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055128] [ENSMUST00000199374]
Predicted Effect probably null
Transcript: ENSMUST00000055128
SMART Domains Protein: ENSMUSP00000062110
Gene: ENSMUSG00000046985

DomainStartEndE-ValueType
low complexity region 6 43 N/A INTRINSIC
low complexity region 54 62 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
Pfam:DUF747 152 456 8.9e-112 PFAM
low complexity region 473 489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196151
Predicted Effect probably benign
Transcript: ENSMUST00000197266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198875
Predicted Effect probably benign
Transcript: ENSMUST00000199374
SMART Domains Protein: ENSMUSP00000143625
Gene: ENSMUSG00000046985

DomainStartEndE-ValueType
low complexity region 6 43 N/A INTRINSIC
low complexity region 54 62 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved protein that localizes to the centrosome and/or ciliary basal body. Mutations in this gene disrupt Golgi morphology and trafficking and normal primary cilium formation and these mutations are congenitally manifested by severe undermineralization of the intra-uterine skeleton. A mutation in the mouse ortholog of this gene results in homeotic, posterior-to-anterior transformations of the axial skeleton which are similar to the phenotype of mouse homeobox C8 gene mutants. In mouse, this gene is thought to function downstream of homeobox C8 to transduce extracellular patterning information during axial skeleton development. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for an ENU mutation causing a truncation exhibit vertebral trasnformations and defects in rib attachment and the xiphoid process. Mice homozygous for a transgenic gene disruption exhibit cleft palate and possible anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,231,748 N331S probably benign Het
Adk A G 14: 21,318,074 N189S probably benign Het
Apc T A 18: 34,315,944 N1930K probably damaging Het
Arhgap28 T C 17: 67,864,606 D391G probably damaging Het
Atn1 G T 6: 124,743,371 probably benign Het
C2cd5 T C 6: 143,041,490 E471G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cap2 T C 13: 46,560,547 L34P probably damaging Het
Cdc42ep2 T A 19: 5,918,525 M51L probably benign Het
Cntn5 C T 9: 9,972,870 A254T probably damaging Het
Dicer1 A T 12: 104,704,174 L1044H probably damaging Het
Dkk3 A C 7: 112,158,223 M58R probably damaging Het
Dpy19l3 G A 7: 35,752,705 R5W probably damaging Het
Dsg1c C T 18: 20,283,654 P871S probably damaging Het
Dusp1 A T 17: 26,507,696 S131T probably benign Het
Enpp2 C T 15: 54,882,159 G314R probably damaging Het
Fam222b C A 11: 78,154,930 P439Q probably benign Het
Fastkd2 A T 1: 63,737,811 I369F probably benign Het
Fdps G A 3: 89,094,894 S205F probably damaging Het
Fmo1 A T 1: 162,836,204 V252E possibly damaging Het
Frmd5 A G 2: 121,555,574 Y230H probably damaging Het
Gal C T 19: 3,411,171 V88I probably benign Het
Gm38394 A T 1: 133,656,784 D938E probably damaging Het
Gnptab T C 10: 88,436,525 I1009T probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klhdc7a A T 4: 139,966,705 D310E probably benign Het
Klk4 T C 7: 43,884,008 M97T probably benign Het
Krt82 C T 15: 101,545,593 V227M probably damaging Het
Lpp T C 16: 24,761,837 V226A probably damaging Het
Mbd1 AGCTGACTCGGTAC A 18: 74,273,241 probably null Het
Mcm10 T C 2: 5,004,154 K335E possibly damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myb T C 10: 21,154,712 D62G possibly damaging Het
Nasp A T 4: 116,610,695 N364K probably benign Het
Npsr1 A G 9: 24,313,277 N317D probably damaging Het
Nup210 A G 6: 91,028,795 V619A possibly damaging Het
Oser1 C T 2: 163,411,396 probably null Het
Pcdhb4 T C 18: 37,309,215 F526S probably damaging Het
Plekhh3 T C 11: 101,165,141 N444S probably damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Pou2f2 G A 7: 25,116,076 Q89* probably null Het
Ptprb A G 10: 116,350,178 I1713V probably benign Het
Ptprd A G 4: 76,128,665 Y442H probably damaging Het
Rad21 A T 15: 51,973,863 I152N possibly damaging Het
Ralgapa1 A G 12: 55,677,038 S1568P probably damaging Het
Rhag T A 17: 40,834,727 V357E probably damaging Het
Rnf121 A T 7: 102,029,117 D174E possibly damaging Het
Sdccag3 T C 2: 26,387,659 E41G possibly damaging Het
Sf3b4 T C 3: 96,172,982 Y16H probably damaging Het
Slc1a3 C T 15: 8,639,135 V449I probably damaging Het
Slc20a2 A G 8: 22,568,393 I648M probably benign Het
Slc25a25 T A 2: 32,417,822 I254F probably damaging Het
Slit3 A G 11: 35,700,282 H1307R probably damaging Het
Sorl1 C A 9: 42,031,909 M890I probably damaging Het
Supt16 A C 14: 52,176,718 M468R probably benign Het
Taf4b T C 18: 14,783,760 S56P probably benign Het
Tmco3 T G 8: 13,296,027 C288W probably damaging Het
Tpcn2 A G 7: 145,277,174 Y145H probably damaging Het
Ttn C T 2: 76,881,717 probably benign Het
Usb1 G T 8: 95,345,318 W215C probably damaging Het
Usp2 C G 9: 44,092,750 T305R probably damaging Het
Vmn1r13 G A 6: 57,210,705 S283N probably benign Het
Vps54 A G 11: 21,306,381 K467E possibly damaging Het
Wnk2 G T 13: 49,068,128 S1121Y probably damaging Het
Other mutations in Tapt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01992:Tapt1 APN 5 44178990 missense probably damaging 1.00
IGL03011:Tapt1 APN 5 44193187 missense possibly damaging 0.58
IGL03018:Tapt1 APN 5 44204324 missense probably damaging 1.00
R0624:Tapt1 UTSW 5 44177106 missense possibly damaging 0.81
R1491:Tapt1 UTSW 5 44218102 critical splice donor site probably null
R2423:Tapt1 UTSW 5 44192453 missense probably benign 0.08
R4175:Tapt1 UTSW 5 44177105 missense probably benign 0.02
R5794:Tapt1 UTSW 5 44177134 missense probably benign 0.00
R7344:Tapt1 UTSW 5 44188657 missense probably damaging 1.00
R7355:Tapt1 UTSW 5 44177117 missense probably benign
R7464:Tapt1 UTSW 5 44188688 nonsense probably null
R7491:Tapt1 UTSW 5 44188636 missense probably damaging 1.00
X0062:Tapt1 UTSW 5 44194357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGCAAATGTGTACCAGAGTGAAG -3'
(R):5'- TTACCTATGGCTCCAGCCTGTGAG -3'

Sequencing Primer
(F):5'- ATGTTCTTCGTACTAAAACCAGC -3'
(R):5'- CCAGCCTGTGAGTTCTTGATAAAC -3'
Posted On2013-08-08