Mutagenetix > Incidental Mutations

Incidental Mutation 'R8454:Slitrk6'

654953

Institutional Source

Beutler Lab

Gene Symbol

Slitrk6

Ensembl Gene

ENSMUSG00000045871

Gene Name

SLIT and NTRK-like family, member 6

Synonyms

4832410J21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.196) question?

Stock #

R8454 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110748580-110755149 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 110752046 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 76 (L76F)

Ref Sequence

ENSEMBL: ENSMUSP00000077492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078386]

Predicted Effect

probably damaging
Transcript: ENSMUST00000078386
AA Change: L76F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000077492
Gene: ENSMUSG00000045871
AA Change: L76F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:LRRNT	30	68	4e-15	BLAST
LRR	87	110	1.71e1	SMART
LRR	111	134	3.07e-1	SMART
LRR	135	158	4.44e0	SMART
LRR_TYP	159	182	2.09e-3	SMART
LRR	185	206	6.23e1	SMART
LRRCT	218	268	5.61e-5	SMART
low complexity region	287	301	N/A	INTRINSIC
Blast:LRRNT	327	364	2e-17	BLAST
LRR	388	408	2.68e1	SMART
LRR_TYP	409	432	3.63e-3	SMART
LRR_TYP	433	456	6.23e-2	SMART
LRR_TYP	457	480	3.69e-4	SMART
low complexity region	501	513	N/A	INTRINSIC
LRRCT	516	566	1.53e-6	SMART
transmembrane domain	610	632	N/A	INTRINSIC
low complexity region	634	642	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. This protein functions as a regulator of neurite outgrowth required for normal hearing and vision. Mutations in this gene are a cause of myopia and deafness. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous deficient mice show pronounced reduction in cochlear innervation. Innervation to the posterior crista is variably impaired and a there is a loss of neurons in the spiral and vestibular ganglia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	A	7: 118,792,572	F493Y	probably benign	Het
Abcc10	C	A	17: 46,324,177	G300V	possibly damaging	Het
Adgrg7	C	G	16: 56,795,682		probably benign	Het
Agt	G	A	8: 124,564,103	T155M	probably benign	Het
Atp8b3	A	G	10: 80,525,799	V763A	probably benign	Het
Btn1a1	C	A	13: 23,464,250	V138L	probably benign	Het
Cd163	A	T	6: 124,328,965	N1109I	probably benign	Het
Cideb	T	A	14: 55,755,141	Q106L	possibly damaging	Het
Cntn1	A	G	15: 92,232,249	T126A	probably benign	Het
Dusp27	A	T	1: 166,108,133	N165K	probably damaging	Het
Elfn1	T	C	5: 139,971,471	Y77H	probably damaging	Het
Eml3	A	G	19: 8,934,994	H386R	probably damaging	Het
Fbxo21	A	G	5: 117,995,414	D413G	probably damaging	Het
Fkbp8	T	A	8: 70,531,763		probably null	Het
Fzd1	T	C	5: 4,757,336	Q82R	probably benign	Het
Gast	T	C	11: 100,336,568	L29P	probably benign	Het
Glb1l2	C	A	9: 26,806,417		probably benign	Het
Gm1110	C	G	9: 26,883,280	Q483H	probably benign	Het
Gm1110	T	A	9: 26,883,281	Q483L	probably benign	Het
Gm5737	T	A	7: 120,831,180	V420E	possibly damaging	Het
Gpc6	T	C	14: 116,925,979	L15P	probably damaging	Het
Hagh	C	A	17: 24,857,562	S161*	probably null	Het
Hrh1	A	G	6: 114,480,853	D365G	probably benign	Het
Ighv1-36	A	T	12: 114,879,940	M100K	probably damaging	Het
Itgb8	A	T	12: 119,170,778	V518D	probably benign	Het
Krt82	T	C	15: 101,541,803	Y486C	probably damaging	Het
Lmbr1l	A	G	15: 98,912,476	S85P	probably damaging	Het
Met	A	G	6: 17,491,769	S177G	probably damaging	Het
Myl9	T	A	2: 156,781,128	I162N	possibly damaging	Het
Npat	T	A	9: 53,566,951	N973K	possibly damaging	Het
Olfr493	A	T	7: 108,346,682	C100S	probably damaging	Het
Pcdhga12	A	T	18: 37,768,137	D674V	possibly damaging	Het
Phtf1	T	A	3: 104,004,449	N702K	probably damaging	Het
Plaa	A	T	4: 94,569,477	I752N	probably damaging	Het
Pnpla2	T	C	7: 141,458,098	C194R	probably damaging	Het
Rnaseh2a	T	C	8: 84,965,147	N133S	probably benign	Het
Rps6ka1	T	A	4: 133,848,553	Q685L	probably benign	Het
Ryr1	C	A	7: 29,015,717	G4661C	unknown	Het
Samd13	T	A	3: 146,646,402	M65L	probably benign	Het
Sec22c	A	G	9: 121,695,655	S21P	probably damaging	Het
Sh3d19	C	A	3: 86,107,022	T431K	probably benign	Het
Sin3b	A	G	8: 72,741,480	M277V	probably benign	Het
Sis	T	C	3: 72,947,501	T468A	possibly damaging	Het
Slitrk3	T	C	3: 73,049,180	N753S	probably benign	Het
Stk3	C	T	15: 34,876,724	A478T	probably damaging	Het
Sugp1	C	A	8: 70,071,597	Y617*	probably null	Het
Tinag	T	C	9: 77,031,695	D167G	probably damaging	Het
Tk2	A	G	8: 104,241,114		probably null	Het
Tmem209	A	T	6: 30,489,309	V514D	probably damaging	Het
Tmprss9	A	G	10: 80,887,486	H260R	probably benign	Het
Tnfrsf14	T	A	4: 154,926,655	Y83F	possibly damaging	Het
Tnfrsf8	A	T	4: 145,287,983	D285E	probably benign	Het
Togaram2	C	G	17: 71,697,878	A310G	probably benign	Het
Trpv3	A	G	11: 73,291,622	Y544C	probably damaging	Het
Ttl	T	A	2: 129,066,184	V13D	probably damaging	Het
Usp40	A	T	1: 87,980,972	D602E	probably benign	Het
Vamp5	A	G	6: 72,370,393		probably benign	Het
Vmn2r65	T	A	7: 84,940,194	H838L	possibly damaging	Het
Wdr63	T	C	3: 146,097,227	K70E	probably damaging	Het
Zfp960	T	A	17: 17,088,199	Y392N	probably benign	Het

Other mutations in Slitrk6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Slitrk6	APN	14	110751115	missense	probably benign	0.35
IGL01131:Slitrk6	APN	14	110751576	missense	probably damaging	1.00
IGL01294:Slitrk6	APN	14	110750074	missense	probably benign
IGL01295:Slitrk6	APN	14	110751436	missense	possibly damaging	0.50
IGL01762:Slitrk6	APN	14	110751624	missense	probably damaging	1.00
IGL02165:Slitrk6	APN	14	110751817	missense	probably benign	0.41
IGL02546:Slitrk6	APN	14	110749794	missense	probably benign	0.18
IGL03103:Slitrk6	APN	14	110749941	missense	probably benign
PIT1430001:Slitrk6	UTSW	14	110750427	missense	possibly damaging	0.93
PIT4480001:Slitrk6	UTSW	14	110749825	frame shift	probably null
R0035:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0066:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0067:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0069:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0107:Slitrk6	UTSW	14	110751963	missense	possibly damaging	0.69
R0157:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0422:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0422:Slitrk6	UTSW	14	110752293	start gained	probably benign
R0454:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0505:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0633:Slitrk6	UTSW	14	110751885	missense	probably damaging	1.00
R0711:Slitrk6	UTSW	14	110749819	missense	probably damaging	1.00
R0843:Slitrk6	UTSW	14	110750098	missense	probably benign
R1298:Slitrk6	UTSW	14	110751865	missense	possibly damaging	0.94
R1693:Slitrk6	UTSW	14	110750928	missense	probably damaging	1.00
R1756:Slitrk6	UTSW	14	110750552	missense	probably benign
R1998:Slitrk6	UTSW	14	110751823	missense	probably damaging	0.99
R2049:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2140:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2142:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2314:Slitrk6	UTSW	14	110751955	missense	probably damaging	1.00
R2566:Slitrk6	UTSW	14	110750272	missense	probably benign	0.00
R4231:Slitrk6	UTSW	14	110751388	missense	probably benign	0.02
R4236:Slitrk6	UTSW	14	110750148	missense	probably benign	0.07
R4247:Slitrk6	UTSW	14	110750739	missense	probably damaging	1.00
R4576:Slitrk6	UTSW	14	110750170	missense	probably benign	0.05
R4856:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4858:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4859:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4860:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4860:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4886:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4931:Slitrk6	UTSW	14	110750379	missense	probably damaging	1.00
R5255:Slitrk6	UTSW	14	110749753	makesense	probably null
R5281:Slitrk6	UTSW	14	110750373	missense	probably damaging	1.00
R5450:Slitrk6	UTSW	14	110750097	missense	probably benign
R5579:Slitrk6	UTSW	14	110751217	missense	possibly damaging	0.82
R5689:Slitrk6	UTSW	14	110752126	missense	probably benign
R5935:Slitrk6	UTSW	14	110749873	missense	probably benign	0.00
R6016:Slitrk6	UTSW	14	110750526	missense	probably benign	0.00
R6312:Slitrk6	UTSW	14	110750247	missense	probably benign	0.00
R6890:Slitrk6	UTSW	14	110751096	nonsense	probably null
R6952:Slitrk6	UTSW	14	110750542	missense	probably benign
R7378:Slitrk6	UTSW	14	110749863	missense	probably damaging	1.00
R8354:Slitrk6	UTSW	14	110752046	missense	probably damaging	1.00
R8401:Slitrk6	UTSW	14	110752021	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- AGCCTGTTGAGCTTGCTGAAG -3'
(R):5'- AGTCACCAATGCCCTCAGTC -3'

Sequencing Primer
(F):5'- GCCTGCAAGAATTCCAGGTTC -3'
(R):5'- TCAGTCAGAGGCTCTTGCGAC -3'

Posted On

2020-10-20