Incidental Mutation 'R8454:Slitrk6'
ID654953
Institutional Source Beutler Lab
Gene Symbol Slitrk6
Ensembl Gene ENSMUSG00000045871
Gene NameSLIT and NTRK-like family, member 6
Synonyms4832410J21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R8454 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location110748580-110755149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 110752046 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 76 (L76F)
Ref Sequence ENSEMBL: ENSMUSP00000077492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078386]
Predicted Effect probably damaging
Transcript: ENSMUST00000078386
AA Change: L76F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077492
Gene: ENSMUSG00000045871
AA Change: L76F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:LRRNT 30 68 4e-15 BLAST
LRR 87 110 1.71e1 SMART
LRR 111 134 3.07e-1 SMART
LRR 135 158 4.44e0 SMART
LRR_TYP 159 182 2.09e-3 SMART
LRR 185 206 6.23e1 SMART
LRRCT 218 268 5.61e-5 SMART
low complexity region 287 301 N/A INTRINSIC
Blast:LRRNT 327 364 2e-17 BLAST
LRR 388 408 2.68e1 SMART
LRR_TYP 409 432 3.63e-3 SMART
LRR_TYP 433 456 6.23e-2 SMART
LRR_TYP 457 480 3.69e-4 SMART
low complexity region 501 513 N/A INTRINSIC
LRRCT 516 566 1.53e-6 SMART
transmembrane domain 610 632 N/A INTRINSIC
low complexity region 634 642 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. This protein functions as a regulator of neurite outgrowth required for normal hearing and vision. Mutations in this gene are a cause of myopia and deafness. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous deficient mice show pronounced reduction in cochlear innervation. Innervation to the posterior crista is variably impaired and a there is a loss of neurons in the spiral and vestibular ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,792,572 F493Y probably benign Het
Abcc10 C A 17: 46,324,177 G300V possibly damaging Het
Adgrg7 C G 16: 56,795,682 probably benign Het
Agt G A 8: 124,564,103 T155M probably benign Het
Atp8b3 A G 10: 80,525,799 V763A probably benign Het
Btn1a1 C A 13: 23,464,250 V138L probably benign Het
Cd163 A T 6: 124,328,965 N1109I probably benign Het
Cideb T A 14: 55,755,141 Q106L possibly damaging Het
Cntn1 A G 15: 92,232,249 T126A probably benign Het
Dusp27 A T 1: 166,108,133 N165K probably damaging Het
Elfn1 T C 5: 139,971,471 Y77H probably damaging Het
Eml3 A G 19: 8,934,994 H386R probably damaging Het
Fbxo21 A G 5: 117,995,414 D413G probably damaging Het
Fkbp8 T A 8: 70,531,763 probably null Het
Fzd1 T C 5: 4,757,336 Q82R probably benign Het
Gast T C 11: 100,336,568 L29P probably benign Het
Glb1l2 C A 9: 26,806,417 probably benign Het
Gm1110 C G 9: 26,883,280 Q483H probably benign Het
Gm1110 T A 9: 26,883,281 Q483L probably benign Het
Gm5737 T A 7: 120,831,180 V420E possibly damaging Het
Gpc6 T C 14: 116,925,979 L15P probably damaging Het
Hagh C A 17: 24,857,562 S161* probably null Het
Hrh1 A G 6: 114,480,853 D365G probably benign Het
Ighv1-36 A T 12: 114,879,940 M100K probably damaging Het
Itgb8 A T 12: 119,170,778 V518D probably benign Het
Krt82 T C 15: 101,541,803 Y486C probably damaging Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Met A G 6: 17,491,769 S177G probably damaging Het
Myl9 T A 2: 156,781,128 I162N possibly damaging Het
Npat T A 9: 53,566,951 N973K possibly damaging Het
Olfr493 A T 7: 108,346,682 C100S probably damaging Het
Pcdhga12 A T 18: 37,768,137 D674V possibly damaging Het
Phtf1 T A 3: 104,004,449 N702K probably damaging Het
Plaa A T 4: 94,569,477 I752N probably damaging Het
Pnpla2 T C 7: 141,458,098 C194R probably damaging Het
Rnaseh2a T C 8: 84,965,147 N133S probably benign Het
Rps6ka1 T A 4: 133,848,553 Q685L probably benign Het
Ryr1 C A 7: 29,015,717 G4661C unknown Het
Samd13 T A 3: 146,646,402 M65L probably benign Het
Sec22c A G 9: 121,695,655 S21P probably damaging Het
Sh3d19 C A 3: 86,107,022 T431K probably benign Het
Sin3b A G 8: 72,741,480 M277V probably benign Het
Sis T C 3: 72,947,501 T468A possibly damaging Het
Slitrk3 T C 3: 73,049,180 N753S probably benign Het
Stk3 C T 15: 34,876,724 A478T probably damaging Het
Sugp1 C A 8: 70,071,597 Y617* probably null Het
Tinag T C 9: 77,031,695 D167G probably damaging Het
Tk2 A G 8: 104,241,114 probably null Het
Tmem209 A T 6: 30,489,309 V514D probably damaging Het
Tmprss9 A G 10: 80,887,486 H260R probably benign Het
Tnfrsf14 T A 4: 154,926,655 Y83F possibly damaging Het
Tnfrsf8 A T 4: 145,287,983 D285E probably benign Het
Togaram2 C G 17: 71,697,878 A310G probably benign Het
Trpv3 A G 11: 73,291,622 Y544C probably damaging Het
Ttl T A 2: 129,066,184 V13D probably damaging Het
Usp40 A T 1: 87,980,972 D602E probably benign Het
Vamp5 A G 6: 72,370,393 probably benign Het
Vmn2r65 T A 7: 84,940,194 H838L possibly damaging Het
Wdr63 T C 3: 146,097,227 K70E probably damaging Het
Zfp960 T A 17: 17,088,199 Y392N probably benign Het
Other mutations in Slitrk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Slitrk6 APN 14 110751115 missense probably benign 0.35
IGL01131:Slitrk6 APN 14 110751576 missense probably damaging 1.00
IGL01294:Slitrk6 APN 14 110750074 missense probably benign
IGL01295:Slitrk6 APN 14 110751436 missense possibly damaging 0.50
IGL01762:Slitrk6 APN 14 110751624 missense probably damaging 1.00
IGL02165:Slitrk6 APN 14 110751817 missense probably benign 0.41
IGL02546:Slitrk6 APN 14 110749794 missense probably benign 0.18
IGL03103:Slitrk6 APN 14 110749941 missense probably benign
PIT1430001:Slitrk6 UTSW 14 110750427 missense possibly damaging 0.93
PIT4480001:Slitrk6 UTSW 14 110749825 frame shift probably null
R0035:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0066:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0067:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0069:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0107:Slitrk6 UTSW 14 110751963 missense possibly damaging 0.69
R0157:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0422:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0422:Slitrk6 UTSW 14 110752293 start gained probably benign
R0454:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0505:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0633:Slitrk6 UTSW 14 110751885 missense probably damaging 1.00
R0711:Slitrk6 UTSW 14 110749819 missense probably damaging 1.00
R0843:Slitrk6 UTSW 14 110750098 missense probably benign
R1298:Slitrk6 UTSW 14 110751865 missense possibly damaging 0.94
R1693:Slitrk6 UTSW 14 110750928 missense probably damaging 1.00
R1756:Slitrk6 UTSW 14 110750552 missense probably benign
R1998:Slitrk6 UTSW 14 110751823 missense probably damaging 0.99
R2049:Slitrk6 UTSW 14 110750794 missense probably benign 0.00
R2140:Slitrk6 UTSW 14 110750794 missense probably benign 0.00
R2142:Slitrk6 UTSW 14 110750794 missense probably benign 0.00
R2314:Slitrk6 UTSW 14 110751955 missense probably damaging 1.00
R2566:Slitrk6 UTSW 14 110750272 missense probably benign 0.00
R4231:Slitrk6 UTSW 14 110751388 missense probably benign 0.02
R4236:Slitrk6 UTSW 14 110750148 missense probably benign 0.07
R4247:Slitrk6 UTSW 14 110750739 missense probably damaging 1.00
R4576:Slitrk6 UTSW 14 110750170 missense probably benign 0.05
R4856:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4858:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4859:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4860:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4860:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4886:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4931:Slitrk6 UTSW 14 110750379 missense probably damaging 1.00
R5255:Slitrk6 UTSW 14 110749753 makesense probably null
R5281:Slitrk6 UTSW 14 110750373 missense probably damaging 1.00
R5450:Slitrk6 UTSW 14 110750097 missense probably benign
R5579:Slitrk6 UTSW 14 110751217 missense possibly damaging 0.82
R5689:Slitrk6 UTSW 14 110752126 missense probably benign
R5935:Slitrk6 UTSW 14 110749873 missense probably benign 0.00
R6016:Slitrk6 UTSW 14 110750526 missense probably benign 0.00
R6312:Slitrk6 UTSW 14 110750247 missense probably benign 0.00
R6890:Slitrk6 UTSW 14 110751096 nonsense probably null
R6952:Slitrk6 UTSW 14 110750542 missense probably benign
R7378:Slitrk6 UTSW 14 110749863 missense probably damaging 1.00
R8354:Slitrk6 UTSW 14 110752046 missense probably damaging 1.00
R8401:Slitrk6 UTSW 14 110752021 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGCCTGTTGAGCTTGCTGAAG -3'
(R):5'- AGTCACCAATGCCCTCAGTC -3'

Sequencing Primer
(F):5'- GCCTGCAAGAATTCCAGGTTC -3'
(R):5'- TCAGTCAGAGGCTCTTGCGAC -3'
Posted On2020-10-20