Incidental Mutation 'R8454:Gpc6'
ID654954
Institutional Source Beutler Lab
Gene Symbol Gpc6
Ensembl Gene ENSMUSG00000058571
Gene Nameglypican 6
Synonyms6720429C22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R8454 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location116925315-117976544 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116925979 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 15 (L15P)
Ref Sequence ENSEMBL: ENSMUSP00000120362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078849] [ENSMUST00000088483] [ENSMUST00000125435]
Predicted Effect probably damaging
Transcript: ENSMUST00000078849
AA Change: L15P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077893
Gene: ENSMUSG00000058571
AA Change: L15P

DomainStartEndE-ValueType
Pfam:Glypican 7 554 9.3e-247 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000088483
AA Change: L15P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085835
Gene: ENSMUSG00000058571
AA Change: L15P

DomainStartEndE-ValueType
Pfam:Glypican 7 554 9.3e-247 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125435
AA Change: L15P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120362
Gene: ENSMUSG00000058571
AA Change: L15P

DomainStartEndE-ValueType
Pfam:Glypican 15 564 7.2e-248 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glypicans comprise a family of glycosylphosphatidylinositol-anchored heparan sulfate proteoglycans, and they have been implicated in the control of cell growth and cell division. The glypican encoded by this gene is a putative cell surface coreceptor for growth factors, extracellular matrix proteins, proteases and anti-proteases. Mutations in this gene are associated with omodysplasia 1. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased fetal weight, short long bones, small skull, small snout, cleft palate and decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,792,572 F493Y probably benign Het
Abcc10 C A 17: 46,324,177 G300V possibly damaging Het
Adgrg7 C G 16: 56,795,682 probably benign Het
Agt G A 8: 124,564,103 T155M probably benign Het
Atp8b3 A G 10: 80,525,799 V763A probably benign Het
Btn1a1 C A 13: 23,464,250 V138L probably benign Het
Cd163 A T 6: 124,328,965 N1109I probably benign Het
Cideb T A 14: 55,755,141 Q106L possibly damaging Het
Cntn1 A G 15: 92,232,249 T126A probably benign Het
Dusp27 A T 1: 166,108,133 N165K probably damaging Het
Elfn1 T C 5: 139,971,471 Y77H probably damaging Het
Eml3 A G 19: 8,934,994 H386R probably damaging Het
Fbxo21 A G 5: 117,995,414 D413G probably damaging Het
Fkbp8 T A 8: 70,531,763 probably null Het
Fzd1 T C 5: 4,757,336 Q82R probably benign Het
Gast T C 11: 100,336,568 L29P probably benign Het
Glb1l2 C A 9: 26,806,417 probably benign Het
Gm1110 C G 9: 26,883,280 Q483H probably benign Het
Gm1110 T A 9: 26,883,281 Q483L probably benign Het
Gm5737 T A 7: 120,831,180 V420E possibly damaging Het
Hagh C A 17: 24,857,562 S161* probably null Het
Hrh1 A G 6: 114,480,853 D365G probably benign Het
Ighv1-36 A T 12: 114,879,940 M100K probably damaging Het
Itgb8 A T 12: 119,170,778 V518D probably benign Het
Krt82 T C 15: 101,541,803 Y486C probably damaging Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Met A G 6: 17,491,769 S177G probably damaging Het
Myl9 T A 2: 156,781,128 I162N possibly damaging Het
Npat T A 9: 53,566,951 N973K possibly damaging Het
Olfr493 A T 7: 108,346,682 C100S probably damaging Het
Pcdhga12 A T 18: 37,768,137 D674V possibly damaging Het
Phtf1 T A 3: 104,004,449 N702K probably damaging Het
Plaa A T 4: 94,569,477 I752N probably damaging Het
Pnpla2 T C 7: 141,458,098 C194R probably damaging Het
Rnaseh2a T C 8: 84,965,147 N133S probably benign Het
Rps6ka1 T A 4: 133,848,553 Q685L probably benign Het
Ryr1 C A 7: 29,015,717 G4661C unknown Het
Samd13 T A 3: 146,646,402 M65L probably benign Het
Sec22c A G 9: 121,695,655 S21P probably damaging Het
Sh3d19 C A 3: 86,107,022 T431K probably benign Het
Sin3b A G 8: 72,741,480 M277V probably benign Het
Sis T C 3: 72,947,501 T468A possibly damaging Het
Slitrk3 T C 3: 73,049,180 N753S probably benign Het
Slitrk6 C A 14: 110,752,046 L76F probably damaging Het
Stk3 C T 15: 34,876,724 A478T probably damaging Het
Sugp1 C A 8: 70,071,597 Y617* probably null Het
Tinag T C 9: 77,031,695 D167G probably damaging Het
Tk2 A G 8: 104,241,114 probably null Het
Tmem209 A T 6: 30,489,309 V514D probably damaging Het
Tmprss9 A G 10: 80,887,486 H260R probably benign Het
Tnfrsf14 T A 4: 154,926,655 Y83F possibly damaging Het
Tnfrsf8 A T 4: 145,287,983 D285E probably benign Het
Togaram2 C G 17: 71,697,878 A310G probably benign Het
Trpv3 A G 11: 73,291,622 Y544C probably damaging Het
Ttl T A 2: 129,066,184 V13D probably damaging Het
Usp40 A T 1: 87,980,972 D602E probably benign Het
Vamp5 A G 6: 72,370,393 probably benign Het
Vmn2r65 T A 7: 84,940,194 H838L possibly damaging Het
Wdr63 T C 3: 146,097,227 K70E probably damaging Het
Zfp960 T A 17: 17,088,199 Y392N probably benign Het
Other mutations in Gpc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gpc6 APN 14 117951234 missense probably benign 0.01
IGL00671:Gpc6 APN 14 117186787 missense probably benign 0.01
IGL00928:Gpc6 APN 14 116925958 missense possibly damaging 0.86
IGL01343:Gpc6 APN 14 117186812 missense possibly damaging 0.54
IGL01545:Gpc6 APN 14 117964830 missense probably damaging 1.00
IGL02797:Gpc6 APN 14 116925982 missense probably damaging 0.98
PIT1430001:Gpc6 UTSW 14 117951182 nonsense probably null
R0577:Gpc6 UTSW 14 117436008 missense probably benign 0.03
R0611:Gpc6 UTSW 14 117975018 missense probably null
R0636:Gpc6 UTSW 14 117624493 missense probably benign 0.37
R2152:Gpc6 UTSW 14 116926092 missense probably benign 0.00
R2242:Gpc6 UTSW 14 117186787 missense probably benign 0.01
R2266:Gpc6 UTSW 14 117888520 critical splice acceptor site probably null
R2267:Gpc6 UTSW 14 117888520 critical splice acceptor site probably null
R2269:Gpc6 UTSW 14 117888520 critical splice acceptor site probably null
R3788:Gpc6 UTSW 14 117624466 missense probably damaging 0.98
R4255:Gpc6 UTSW 14 117951141 missense probably benign 0.15
R4276:Gpc6 UTSW 14 117435916 missense probably damaging 0.99
R4411:Gpc6 UTSW 14 117951178 missense probably benign 0.45
R4626:Gpc6 UTSW 14 117964843 nonsense probably null
R4993:Gpc6 UTSW 14 117624539 missense possibly damaging 0.93
R5070:Gpc6 UTSW 14 117186769 missense probably benign 0.01
R6007:Gpc6 UTSW 14 117951261 missense probably damaging 1.00
R6058:Gpc6 UTSW 14 117964770 missense probably damaging 1.00
R6488:Gpc6 UTSW 14 117964713 missense possibly damaging 0.73
R6901:Gpc6 UTSW 14 117951217 missense possibly damaging 0.87
R6981:Gpc6 UTSW 14 117624548 missense probably damaging 0.98
R7200:Gpc6 UTSW 14 117964856 missense probably benign 0.08
R8348:Gpc6 UTSW 14 117435820 missense probably damaging 1.00
R8354:Gpc6 UTSW 14 116925979 missense probably damaging 0.98
R8413:Gpc6 UTSW 14 117892349 missense possibly damaging 0.93
R8518:Gpc6 UTSW 14 116925972 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CTCCATCTGGCTTATAAAAGTTTGC -3'
(R):5'- AAGTGAGCACCAACTGAGC -3'

Sequencing Primer
(F):5'- TGAGTGCAGTCCAGAGGTC -3'
(R):5'- CTGAGCAACAGGGGGTAGG -3'
Posted On2020-10-20