Incidental Mutation 'R8454:Stk3'
ID654955
Institutional Source Beutler Lab
Gene Symbol Stk3
Ensembl Gene ENSMUSG00000022329
Gene Nameserine/threonine kinase 3
Synonymsmess1, MST, Mst2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8454 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location34875496-35178921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34876724 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 478 (A478T)
Ref Sequence ENSEMBL: ENSMUSP00000018476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018476] [ENSMUST00000067033] [ENSMUST00000226555]
Predicted Effect probably damaging
Transcript: ENSMUST00000018476
AA Change: A478T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018476
Gene: ENSMUSG00000022329
AA Change: A478T

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 27 278 4.16e-103 SMART
low complexity region 301 324 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
Pfam:Mst1_SARAH 443 490 9.6e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067033
AA Change: A408T

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000064225
Gene: ENSMUSG00000022329
AA Change: A408T

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 5 205 2.1e-41 PFAM
Pfam:Pkinase 5 208 1.2e-56 PFAM
coiled coil region 217 256 N/A INTRINSIC
low complexity region 300 311 N/A INTRINSIC
Pfam:Mst1_SARAH 372 420 9.8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226555
AA Change: A476T

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous inactivation of this gene generally results in mice that are viable, fertile and developmentally normal. A small subset of mice homozygous for a knock-out allele develop mammary tumors in the absence of immunological defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,792,572 F493Y probably benign Het
Abcc10 C A 17: 46,324,177 G300V possibly damaging Het
Adgrg7 C G 16: 56,795,682 probably benign Het
Agt G A 8: 124,564,103 T155M probably benign Het
Atp8b3 A G 10: 80,525,799 V763A probably benign Het
Btn1a1 C A 13: 23,464,250 V138L probably benign Het
Cd163 A T 6: 124,328,965 N1109I probably benign Het
Cideb T A 14: 55,755,141 Q106L possibly damaging Het
Cntn1 A G 15: 92,232,249 T126A probably benign Het
Dusp27 A T 1: 166,108,133 N165K probably damaging Het
Elfn1 T C 5: 139,971,471 Y77H probably damaging Het
Eml3 A G 19: 8,934,994 H386R probably damaging Het
Fbxo21 A G 5: 117,995,414 D413G probably damaging Het
Fkbp8 T A 8: 70,531,763 probably null Het
Fzd1 T C 5: 4,757,336 Q82R probably benign Het
Gast T C 11: 100,336,568 L29P probably benign Het
Glb1l2 C A 9: 26,806,417 probably benign Het
Gm1110 C G 9: 26,883,280 Q483H probably benign Het
Gm1110 T A 9: 26,883,281 Q483L probably benign Het
Gm5737 T A 7: 120,831,180 V420E possibly damaging Het
Gpc6 T C 14: 116,925,979 L15P probably damaging Het
Hagh C A 17: 24,857,562 S161* probably null Het
Hrh1 A G 6: 114,480,853 D365G probably benign Het
Ighv1-36 A T 12: 114,879,940 M100K probably damaging Het
Itgb8 A T 12: 119,170,778 V518D probably benign Het
Krt82 T C 15: 101,541,803 Y486C probably damaging Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Met A G 6: 17,491,769 S177G probably damaging Het
Myl9 T A 2: 156,781,128 I162N possibly damaging Het
Npat T A 9: 53,566,951 N973K possibly damaging Het
Olfr493 A T 7: 108,346,682 C100S probably damaging Het
Pcdhga12 A T 18: 37,768,137 D674V possibly damaging Het
Phtf1 T A 3: 104,004,449 N702K probably damaging Het
Plaa A T 4: 94,569,477 I752N probably damaging Het
Pnpla2 T C 7: 141,458,098 C194R probably damaging Het
Rnaseh2a T C 8: 84,965,147 N133S probably benign Het
Rps6ka1 T A 4: 133,848,553 Q685L probably benign Het
Ryr1 C A 7: 29,015,717 G4661C unknown Het
Samd13 T A 3: 146,646,402 M65L probably benign Het
Sec22c A G 9: 121,695,655 S21P probably damaging Het
Sh3d19 C A 3: 86,107,022 T431K probably benign Het
Sin3b A G 8: 72,741,480 M277V probably benign Het
Sis T C 3: 72,947,501 T468A possibly damaging Het
Slitrk3 T C 3: 73,049,180 N753S probably benign Het
Slitrk6 C A 14: 110,752,046 L76F probably damaging Het
Sugp1 C A 8: 70,071,597 Y617* probably null Het
Tinag T C 9: 77,031,695 D167G probably damaging Het
Tk2 A G 8: 104,241,114 probably null Het
Tmem209 A T 6: 30,489,309 V514D probably damaging Het
Tmprss9 A G 10: 80,887,486 H260R probably benign Het
Tnfrsf14 T A 4: 154,926,655 Y83F possibly damaging Het
Tnfrsf8 A T 4: 145,287,983 D285E probably benign Het
Togaram2 C G 17: 71,697,878 A310G probably benign Het
Trpv3 A G 11: 73,291,622 Y544C probably damaging Het
Ttl T A 2: 129,066,184 V13D probably damaging Het
Usp40 A T 1: 87,980,972 D602E probably benign Het
Vamp5 A G 6: 72,370,393 probably benign Het
Vmn2r65 T A 7: 84,940,194 H838L possibly damaging Het
Wdr63 T C 3: 146,097,227 K70E probably damaging Het
Zfp960 T A 17: 17,088,199 Y392N probably benign Het
Other mutations in Stk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Stk3 APN 15 35114622 missense possibly damaging 0.93
IGL02133:Stk3 APN 15 35099516 missense probably damaging 1.00
IGL03121:Stk3 APN 15 35099426 splice site probably benign
IGL03309:Stk3 APN 15 35099551 splice site probably benign
R0276:Stk3 UTSW 15 35099469 missense probably damaging 1.00
R0416:Stk3 UTSW 15 35114632 missense probably benign 0.07
R1352:Stk3 UTSW 15 35008225 missense probably damaging 1.00
R1633:Stk3 UTSW 15 34959060 missense probably damaging 1.00
R1638:Stk3 UTSW 15 35008308 splice site probably null
R1917:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R1919:Stk3 UTSW 15 35073217 missense probably damaging 1.00
R2011:Stk3 UTSW 15 35072498 missense probably damaging 1.00
R2072:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2073:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R2075:Stk3 UTSW 15 34959049 missense possibly damaging 0.79
R3158:Stk3 UTSW 15 35008241 missense possibly damaging 0.83
R3402:Stk3 UTSW 15 34944998 splice site probably benign
R4633:Stk3 UTSW 15 34958928 missense probably damaging 0.99
R4672:Stk3 UTSW 15 35099457 missense probably benign 0.06
R4687:Stk3 UTSW 15 35114565 missense probably damaging 0.99
R4825:Stk3 UTSW 15 34999908 missense probably benign 0.14
R4903:Stk3 UTSW 15 34959066 missense probably damaging 0.99
R5390:Stk3 UTSW 15 35114560 nonsense probably null
R5834:Stk3 UTSW 15 34959018 missense probably damaging 1.00
R7208:Stk3 UTSW 15 35073116 missense possibly damaging 0.76
R7266:Stk3 UTSW 15 34959036 missense probably benign 0.05
R7862:Stk3 UTSW 15 35115586 missense possibly damaging 0.90
R8354:Stk3 UTSW 15 34876724 missense probably damaging 1.00
X0021:Stk3 UTSW 15 35072555 missense probably damaging 1.00
X0060:Stk3 UTSW 15 35114533 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTGGAGACAACTGTAAAGTTTGC -3'
(R):5'- GGTGTGGCTCCTTCAGAAAAG -3'

Sequencing Primer
(F):5'- GAGACAACTGTAAAGTTTGCTTTTGG -3'
(R):5'- TTCTTGCTTTAATTGTTGACATGC -3'
Posted On2020-10-20