Incidental Mutation 'R8454:Krt82'
ID654958
Institutional Source Beutler Lab
Gene Symbol Krt82
Ensembl Gene ENSMUSG00000049548
Gene Namekeratin 82
SynonymsKrt2-20
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R8454 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location101541214-101550667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101541803 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 486 (Y486C)
Ref Sequence ENSEMBL: ENSMUSP00000023713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023713]
Predicted Effect probably damaging
Transcript: ENSMUST00000023713
AA Change: Y486C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023713
Gene: ENSMUSG00000049548
AA Change: Y486C

DomainStartEndE-ValueType
low complexity region 38 57 N/A INTRINSIC
Pfam:Keratin_2_head 61 114 6.1e-13 PFAM
Filament 117 428 1.32e-153 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this keratin appears to be a hair cuticle-specific keratin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,792,572 F493Y probably benign Het
Abcc10 C A 17: 46,324,177 G300V possibly damaging Het
Adgrg7 C G 16: 56,795,682 probably benign Het
Agt G A 8: 124,564,103 T155M probably benign Het
Atp8b3 A G 10: 80,525,799 V763A probably benign Het
Btn1a1 C A 13: 23,464,250 V138L probably benign Het
Cd163 A T 6: 124,328,965 N1109I probably benign Het
Cideb T A 14: 55,755,141 Q106L possibly damaging Het
Cntn1 A G 15: 92,232,249 T126A probably benign Het
Dusp27 A T 1: 166,108,133 N165K probably damaging Het
Elfn1 T C 5: 139,971,471 Y77H probably damaging Het
Eml3 A G 19: 8,934,994 H386R probably damaging Het
Fbxo21 A G 5: 117,995,414 D413G probably damaging Het
Fkbp8 T A 8: 70,531,763 probably null Het
Fzd1 T C 5: 4,757,336 Q82R probably benign Het
Gast T C 11: 100,336,568 L29P probably benign Het
Glb1l2 C A 9: 26,806,417 probably benign Het
Gm1110 C G 9: 26,883,280 Q483H probably benign Het
Gm1110 T A 9: 26,883,281 Q483L probably benign Het
Gm5737 T A 7: 120,831,180 V420E possibly damaging Het
Gpc6 T C 14: 116,925,979 L15P probably damaging Het
Hagh C A 17: 24,857,562 S161* probably null Het
Hrh1 A G 6: 114,480,853 D365G probably benign Het
Ighv1-36 A T 12: 114,879,940 M100K probably damaging Het
Itgb8 A T 12: 119,170,778 V518D probably benign Het
Lmbr1l A G 15: 98,912,476 S85P probably damaging Het
Met A G 6: 17,491,769 S177G probably damaging Het
Myl9 T A 2: 156,781,128 I162N possibly damaging Het
Npat T A 9: 53,566,951 N973K possibly damaging Het
Olfr493 A T 7: 108,346,682 C100S probably damaging Het
Pcdhga12 A T 18: 37,768,137 D674V possibly damaging Het
Phtf1 T A 3: 104,004,449 N702K probably damaging Het
Plaa A T 4: 94,569,477 I752N probably damaging Het
Pnpla2 T C 7: 141,458,098 C194R probably damaging Het
Rnaseh2a T C 8: 84,965,147 N133S probably benign Het
Rps6ka1 T A 4: 133,848,553 Q685L probably benign Het
Ryr1 C A 7: 29,015,717 G4661C unknown Het
Samd13 T A 3: 146,646,402 M65L probably benign Het
Sec22c A G 9: 121,695,655 S21P probably damaging Het
Sh3d19 C A 3: 86,107,022 T431K probably benign Het
Sin3b A G 8: 72,741,480 M277V probably benign Het
Sis T C 3: 72,947,501 T468A possibly damaging Het
Slitrk3 T C 3: 73,049,180 N753S probably benign Het
Slitrk6 C A 14: 110,752,046 L76F probably damaging Het
Stk3 C T 15: 34,876,724 A478T probably damaging Het
Sugp1 C A 8: 70,071,597 Y617* probably null Het
Tinag T C 9: 77,031,695 D167G probably damaging Het
Tk2 A G 8: 104,241,114 probably null Het
Tmem209 A T 6: 30,489,309 V514D probably damaging Het
Tmprss9 A G 10: 80,887,486 H260R probably benign Het
Tnfrsf14 T A 4: 154,926,655 Y83F possibly damaging Het
Tnfrsf8 A T 4: 145,287,983 D285E probably benign Het
Togaram2 C G 17: 71,697,878 A310G probably benign Het
Trpv3 A G 11: 73,291,622 Y544C probably damaging Het
Ttl T A 2: 129,066,184 V13D probably damaging Het
Usp40 A T 1: 87,980,972 D602E probably benign Het
Vamp5 A G 6: 72,370,393 probably benign Het
Vmn2r65 T A 7: 84,940,194 H838L possibly damaging Het
Wdr63 T C 3: 146,097,227 K70E probably damaging Het
Zfp960 T A 17: 17,088,199 Y392N probably benign Het
Other mutations in Krt82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Krt82 APN 15 101543378 missense probably damaging 0.97
IGL01112:Krt82 APN 15 101545523 missense probably damaging 1.00
IGL01820:Krt82 APN 15 101543452 splice site probably benign
IGL02529:Krt82 APN 15 101550396 nonsense probably null
IGL02894:Krt82 APN 15 101542720 missense probably damaging 1.00
IGL02974:Krt82 APN 15 101550585 nonsense probably null
IGL03263:Krt82 APN 15 101541872 missense probably benign 0.00
R0268:Krt82 UTSW 15 101541713 missense probably benign 0.02
R0385:Krt82 UTSW 15 101545593 missense probably damaging 1.00
R0542:Krt82 UTSW 15 101545600 splice site probably benign
R1073:Krt82 UTSW 15 101550254 missense probably damaging 1.00
R1601:Krt82 UTSW 15 101545153 missense probably damaging 1.00
R1795:Krt82 UTSW 15 101543384 missense possibly damaging 0.90
R1944:Krt82 UTSW 15 101548535 missense probably damaging 1.00
R1974:Krt82 UTSW 15 101545162 missense probably benign 0.00
R2049:Krt82 UTSW 15 101545156 missense probably damaging 0.96
R2140:Krt82 UTSW 15 101545156 missense probably damaging 0.96
R2851:Krt82 UTSW 15 101548435 missense probably damaging 1.00
R2852:Krt82 UTSW 15 101548435 missense probably damaging 1.00
R2853:Krt82 UTSW 15 101548435 missense probably damaging 1.00
R3815:Krt82 UTSW 15 101550600 missense probably damaging 1.00
R4324:Krt82 UTSW 15 101541747 missense probably benign 0.00
R4798:Krt82 UTSW 15 101550488 missense probably benign 0.01
R4980:Krt82 UTSW 15 101545099 missense possibly damaging 0.85
R5212:Krt82 UTSW 15 101545049 missense probably damaging 1.00
R5260:Krt82 UTSW 15 101548388 missense possibly damaging 0.88
R5821:Krt82 UTSW 15 101548385 nonsense probably null
R6009:Krt82 UTSW 15 101545105 missense probably benign 0.00
R6955:Krt82 UTSW 15 101542849 missense probably damaging 1.00
R7194:Krt82 UTSW 15 101542756 missense probably damaging 1.00
R7307:Krt82 UTSW 15 101542907 missense probably damaging 0.97
R7420:Krt82 UTSW 15 101545587 missense probably damaging 0.96
R7837:Krt82 UTSW 15 101548357 missense possibly damaging 0.86
R8354:Krt82 UTSW 15 101541803 missense probably damaging 1.00
R8371:Krt82 UTSW 15 101545111 missense probably benign 0.12
Z1176:Krt82 UTSW 15 101541852 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCAGGGCAATGTGTAGTTG -3'
(R):5'- TCCTTGGAGCCAGGTAGAAG -3'

Sequencing Primer
(F):5'- GGGAAGGGAAGAGTTTTGGAATATTC -3'
(R):5'- TTCAGAGACTGGGATGGCC -3'
Posted On2020-10-20