Incidental Mutation 'R8455:Vmn2r95'
ID654988
Institutional Source Beutler Lab
Gene Symbol Vmn2r95
Ensembl Gene ENSMUSG00000091631
Gene Namevomeronasal 2, receptor 95
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R8455 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location18424078-18460905 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18440090 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 255 (T255A)
Ref Sequence ENSEMBL: ENSMUSP00000126106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166327] [ENSMUST00000232090] [ENSMUST00000232464]
Predicted Effect probably benign
Transcript: ENSMUST00000166327
AA Change: T255A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126106
Gene: ENSMUSG00000091631
AA Change: T255A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 462 1.8e-35 PFAM
Pfam:NCD3G 509 562 3.2e-20 PFAM
Pfam:7tm_3 594 830 3.2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232090
AA Change: T255A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232464
AA Change: T255A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgra1 T A 7: 139,875,651 C398* probably null Het
Amy2a1 T A 3: 113,530,396 D165V probably benign Het
Atf6b A G 17: 34,648,223 D63G probably benign Het
BC024139 T C 15: 76,119,807 D753G probably benign Het
Dnah3 T G 7: 119,952,208 T2963P probably damaging Het
Fanci G T 7: 79,435,281 L818F probably damaging Het
Gm4559 C A 7: 142,273,957 C136F unknown Het
Gm45844 G A 7: 7,278,222 probably benign Het
Kmt2c T A 5: 25,354,501 probably null Het
Lpo G A 11: 87,814,288 L407F probably damaging Het
Mus81 T C 19: 5,484,192 Y366C probably damaging Het
Nipbl T C 15: 8,335,044 D1292G probably damaging Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Npepps A T 11: 97,241,974 I309N probably damaging Het
Nufip2 C T 11: 77,692,433 T391I probably damaging Het
Olfr1002 T A 2: 85,648,141 Y60F probably damaging Het
Olfr873 A G 9: 20,300,419 Y74C probably damaging Het
Piezo2 A T 18: 63,090,998 V935E probably damaging Het
Rusc2 A G 4: 43,422,846 I994M probably benign Het
Sgcz T C 8: 37,723,085 I96V probably benign Het
Tmem108 A G 9: 103,499,870 S127P possibly damaging Het
Tmem178b G A 6: 40,254,935 V168I unknown Het
Tut1 T C 19: 8,959,262 V150A probably benign Het
Txnl4a T A 18: 80,207,324 L45Q probably damaging Het
V1ra8 C T 6: 90,203,465 R217W probably damaging Het
Zfp605 A G 5: 110,111,982 probably benign Het
Other mutations in Vmn2r95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Vmn2r95 APN 17 18452328 utr 3 prime probably benign
IGL01479:Vmn2r95 APN 17 18443862 missense probably damaging 1.00
IGL01890:Vmn2r95 APN 17 18451475 missense probably damaging 1.00
IGL01986:Vmn2r95 APN 17 18440211 missense probably benign 0.06
IGL02113:Vmn2r95 APN 17 18439907 missense possibly damaging 0.47
IGL02154:Vmn2r95 APN 17 18451986 missense probably benign 0.16
IGL02190:Vmn2r95 APN 17 18451776 missense probably benign 0.00
IGL02412:Vmn2r95 APN 17 18439956 missense probably damaging 1.00
IGL02550:Vmn2r95 APN 17 18451732 missense probably damaging 1.00
IGL02679:Vmn2r95 APN 17 18443854 missense probably damaging 1.00
IGL02691:Vmn2r95 APN 17 18451858 missense probably benign 0.07
IGL02990:Vmn2r95 APN 17 18452036 nonsense probably null
IGL03032:Vmn2r95 APN 17 18452313 missense probably benign 0.00
R0416:Vmn2r95 UTSW 17 18441402 missense probably damaging 1.00
R0448:Vmn2r95 UTSW 17 18451743 missense possibly damaging 0.92
R0514:Vmn2r95 UTSW 17 18451582 missense probably benign
R0519:Vmn2r95 UTSW 17 18439503 missense probably damaging 1.00
R0539:Vmn2r95 UTSW 17 18452100 missense probably damaging 1.00
R1501:Vmn2r95 UTSW 17 18439856 missense probably damaging 0.99
R1598:Vmn2r95 UTSW 17 18452313 missense probably benign 0.03
R1613:Vmn2r95 UTSW 17 18440639 splice site probably benign
R1861:Vmn2r95 UTSW 17 18452268 missense probably damaging 1.00
R1921:Vmn2r95 UTSW 17 18424313 missense probably benign 0.11
R1986:Vmn2r95 UTSW 17 18451543 missense probably benign
R2031:Vmn2r95 UTSW 17 18439455 missense possibly damaging 0.94
R2040:Vmn2r95 UTSW 17 18441299 missense probably damaging 1.00
R3608:Vmn2r95 UTSW 17 18439973 missense possibly damaging 0.47
R3727:Vmn2r95 UTSW 17 18441482 nonsense probably null
R3953:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R3955:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R3957:Vmn2r95 UTSW 17 18440096 missense possibly damaging 0.79
R4474:Vmn2r95 UTSW 17 18452245 missense probably damaging 1.00
R4672:Vmn2r95 UTSW 17 18452151 missense probably damaging 1.00
R4850:Vmn2r95 UTSW 17 18451653 missense probably damaging 1.00
R5054:Vmn2r95 UTSW 17 18451446 missense possibly damaging 0.63
R5178:Vmn2r95 UTSW 17 18440075 missense probably benign 0.01
R5980:Vmn2r95 UTSW 17 18441362 missense probably benign
R6183:Vmn2r95 UTSW 17 18443930 missense probably damaging 0.99
R6276:Vmn2r95 UTSW 17 18451470 missense possibly damaging 0.96
R6651:Vmn2r95 UTSW 17 18440360 missense probably damaging 1.00
R6682:Vmn2r95 UTSW 17 18440227 missense probably damaging 1.00
R6797:Vmn2r95 UTSW 17 18452289 utr 3 prime probably benign
R6799:Vmn2r95 UTSW 17 18439293 missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18443919 missense probably damaging 1.00
R6849:Vmn2r95 UTSW 17 18443920 missense probably damaging 1.00
R6982:Vmn2r95 UTSW 17 18452061 missense probably damaging 1.00
R7203:Vmn2r95 UTSW 17 18441315 missense probably benign 0.01
R7226:Vmn2r95 UTSW 17 18451983 missense possibly damaging 0.90
R7240:Vmn2r95 UTSW 17 18451963 missense probably benign 0.15
R7383:Vmn2r95 UTSW 17 18440472 missense probably benign 0.06
R7614:Vmn2r95 UTSW 17 18440090 missense probably benign
R7755:Vmn2r95 UTSW 17 18424105 start codon destroyed probably null 0.99
R7942:Vmn2r95 UTSW 17 18440267 missense possibly damaging 0.74
R8355:Vmn2r95 UTSW 17 18440090 missense probably benign
R8478:Vmn2r95 UTSW 17 18452282 missense probably damaging 1.00
R8547:Vmn2r95 UTSW 17 18443899 missense probably damaging 1.00
R8752:Vmn2r95 UTSW 17 18441476 missense probably damaging 0.98
R8788:Vmn2r95 UTSW 17 18451528 missense probably benign 0.09
R8852:Vmn2r95 UTSW 17 18443851 missense possibly damaging 0.95
Z1088:Vmn2r95 UTSW 17 18440401 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGACACATCTCTTTCACTTGC -3'
(R):5'- CTCAAAATTCTCCCTATAATGGTGC -3'

Sequencing Primer
(F):5'- CACTTGCCATTGTTTCATTGATGG -3'
(R):5'- GGCTTCCATGGAATGAGTCTAAC -3'
Posted On2020-10-20