Incidental Mutation 'R8456:Arhgef19'
ID655009
Institutional Source Beutler Lab
Gene Symbol Arhgef19
Ensembl Gene ENSMUSG00000028919
Gene NameRho guanine nucleotide exchange factor (GEF) 19
Synonyms6430573B13Rik, WGEF
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R8456 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location141239499-141257564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141250615 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 545 (K545R)
Ref Sequence ENSEMBL: ENSMUSP00000006618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006618] [ENSMUST00000125392] [ENSMUST00000135623] [ENSMUST00000138096] [ENSMUST00000141834] [ENSMUST00000147903]
Predicted Effect probably benign
Transcript: ENSMUST00000006618
AA Change: K545R

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000006618
Gene: ENSMUSG00000028919
AA Change: K545R

DomainStartEndE-ValueType
low complexity region 145 160 N/A INTRINSIC
low complexity region 161 172 N/A INTRINSIC
low complexity region 305 331 N/A INTRINSIC
RhoGEF 380 559 5.51e-43 SMART
PH 593 706 8.86e-6 SMART
SH3 718 775 5.16e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125392
Predicted Effect probably benign
Transcript: ENSMUST00000135623
SMART Domains Protein: ENSMUSP00000119846
Gene: ENSMUSG00000028919

DomainStartEndE-ValueType
low complexity region 145 160 N/A INTRINSIC
low complexity region 161 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138096
Predicted Effect probably benign
Transcript: ENSMUST00000141834
Predicted Effect probably benign
Transcript: ENSMUST00000147903
SMART Domains Protein: ENSMUSP00000120088
Gene: ENSMUSG00000028919

DomainStartEndE-ValueType
low complexity region 147 173 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide exchange factors (GEFs) such as ARHGEF19 accelerate the GTPase activity of Rho GTPases (see RHOA, MIM 165390).[supplied by OMIM, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A G 10: 80,006,526 E1098G probably benign Het
Akap1 T A 11: 88,834,731 probably null Het
Arhgap26 T C 18: 39,111,848 V182A possibly damaging Het
Asph C T 4: 9,537,722 R352Q probably benign Het
B3glct T A 5: 149,726,789 I119N probably damaging Het
Camsap3 C T 8: 3,600,679 R236* probably null Het
Ccser2 A T 14: 36,890,374 M792K probably benign Het
Ceacam5 C T 7: 17,745,699 T247I possibly damaging Het
Dnah9 A G 11: 66,156,938 S19P probably damaging Het
Dtwd1 A G 2: 126,158,531 E129G probably damaging Het
Ebf3 T A 7: 137,199,187 M490L probably benign Het
Erbb4 A G 1: 68,071,630 L1008S probably damaging Het
Ereg C T 5: 91,090,134 P160S possibly damaging Het
Exoc6b ATTT ATTTT 6: 84,844,095 probably null Het
Fmn1 A G 2: 113,365,040 T362A unknown Het
Gm10436 T A 12: 88,177,216 T284S probably benign Het
Gm14326 A T 2: 177,948,519 D16E probably benign Het
H1foo A T 6: 115,948,784 M181L probably benign Het
Herc6 A T 6: 57,598,563 T190S probably benign Het
Hist1h3a A T 13: 23,762,100 F85Y probably damaging Het
Ikbkap ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 4: 56,781,176 probably benign Het
Lama1 T G 17: 67,737,496 I130S Het
Letm2 T C 8: 25,581,713 D391G probably damaging Het
Map3k9 T C 12: 81,734,118 I423V probably damaging Het
Melk T A 4: 44,312,191 C168S possibly damaging Het
Naa16 A T 14: 79,359,475 N356K probably benign Het
Nup214 A G 2: 32,039,360 N1873S probably benign Het
Olfr1392 C T 11: 49,293,558 P79L probably damaging Het
Olfr890 T A 9: 38,143,685 C178* probably null Het
Pom121 A G 5: 135,381,178 F1042L unknown Het
Pxdn T C 12: 30,011,890 S1334P probably damaging Het
Ranbp1 C T 16: 18,245,306 E69K probably damaging Het
Rasl11a T C 5: 146,845,235 S7P probably damaging Het
Rev1 G A 1: 38,059,243 R740* probably null Het
Rnf157 C T 11: 116,349,420 V443M probably benign Het
Scn3a T A 2: 65,460,673 T1910S probably benign Het
Sh2b1 TGGGGACCAGCTCAGCCACGGGGACCAGCTC TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC 7: 126,467,570 probably benign Het
Sh2b1 C CAGCCACGGGGCCTAGCTA 7: 126,467,600 probably null Het
Siah2 T C 3: 58,676,082 N261S probably benign Het
Sumf2 T G 5: 129,860,162 W264G possibly damaging Het
Tal1 G T 4: 115,063,428 A100S probably benign Het
Tmprss9 A G 10: 80,894,417 D717G possibly damaging Het
Tox2 G T 2: 163,204,630 R9L unknown Het
Traj46 A G 14: 54,172,338 E1G Het
Uhrf1bp1l A G 10: 89,812,092 T1339A probably benign Het
Unc80 A G 1: 66,641,629 D2128G possibly damaging Het
Usp21 A T 1: 171,284,717 F308I probably damaging Het
Vgf A T 5: 137,032,411 I476F probably damaging Het
Vps35 G A 8: 85,261,305 T739I possibly damaging Het
Wdr95 G T 5: 149,579,107 C279F probably damaging Het
Zbtb32 T C 7: 30,589,956 S94G unknown Het
Zdhhc13 T A 7: 48,802,999 I153N probably damaging Het
Other mutations in Arhgef19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Arhgef19 APN 4 141248983 unclassified probably benign
IGL02037:Arhgef19 APN 4 141246396 missense probably damaging 0.99
IGL03049:Arhgef19 APN 4 141254316 missense probably damaging 0.98
IGL03071:Arhgef19 APN 4 141249002 missense possibly damaging 0.88
IGL03098:Arhgef19 UTSW 4 141247568 missense possibly damaging 0.85
R0271:Arhgef19 UTSW 4 141250607 missense probably benign 0.00
R0319:Arhgef19 UTSW 4 141256399 missense possibly damaging 0.63
R1572:Arhgef19 UTSW 4 141254754 missense probably benign 0.10
R1633:Arhgef19 UTSW 4 141238560 unclassified probably benign
R1735:Arhgef19 UTSW 4 141249618 missense possibly damaging 0.55
R1752:Arhgef19 UTSW 4 141251043 missense probably benign 0.27
R1823:Arhgef19 UTSW 4 141249146 missense probably benign 0.01
R1889:Arhgef19 UTSW 4 141249313 missense probably damaging 1.00
R2138:Arhgef19 UTSW 4 141250800 missense probably damaging 1.00
R2280:Arhgef19 UTSW 4 141246516 missense probably benign 0.14
R3430:Arhgef19 UTSW 4 141256800 missense probably benign 0.03
R3954:Arhgef19 UTSW 4 141256334 missense probably damaging 1.00
R4158:Arhgef19 UTSW 4 141246349 missense possibly damaging 0.50
R4160:Arhgef19 UTSW 4 141246349 missense possibly damaging 0.50
R4995:Arhgef19 UTSW 4 141247515 splice site probably null
R5031:Arhgef19 UTSW 4 141250810 missense probably damaging 0.98
R5782:Arhgef19 UTSW 4 141256312 missense probably damaging 1.00
R5913:Arhgef19 UTSW 4 141249298 missense probably benign 0.03
R7614:Arhgef19 UTSW 4 141256779 missense possibly damaging 0.52
R8356:Arhgef19 UTSW 4 141250615 missense probably benign 0.25
R8531:Arhgef19 UTSW 4 141249592 missense possibly damaging 0.82
R8876:Arhgef19 UTSW 4 141247882 missense probably benign 0.28
R8931:Arhgef19 UTSW 4 141249292 missense probably damaging 0.98
R8947:Arhgef19 UTSW 4 141246307 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCCCAGGTGACTCTCCTACC -3'
(R):5'- CCCTCAAAATGGATCTTCTTGCTT -3'

Sequencing Primer
(F):5'- AGGTGACTCTCCTACCCTCTTG -3'
(R):5'- TAGGTGAATTAGTTCCTCCGTCCG -3'
Posted On2020-10-20