Mutagenetix > Incidental Mutations

Incidental Mutation 'R0385:Taf4b'

65502

Institutional Source

Beutler Lab

Gene Symbol

Taf4b

Ensembl Gene

ENSMUSG00000054321

Gene Name

TATA-box binding protein associated factor 4b

Synonyms

Taf2c2, TAFII105, 2610524B04Rik, 105kDa, 4932409F03Rik

MMRRC Submission

038591-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.342) question?

Stock #

R0385 (G1)

Quality Score

140

Status

Not validated

Chromosome

Chromosomal Location

14783245-14900359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 14783760 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 56 (S56P)

Ref Sequence

ENSEMBL: ENSMUSP00000126909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169862]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000169862
AA Change: S56P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000126909
Gene: ENSMUSG00000054321
AA Change: S56P

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	185	196	N/A	INTRINSIC
Pfam:TAFH	257	348	5.3e-39	PFAM
low complexity region	359	376	N/A	INTRINSIC
low complexity region	412	422	N/A	INTRINSIC
Pfam:TAF4	610	852	4e-72	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.2%
10x: 96.0%
20x: 92.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TATA binding protein (TBP) and TBP-associated factors (TAFs) participate in the formation of the TFIID protein complex, which is involved in initiation of transcription of genes by RNA polymerase II. This gene encodes a cell type-specific TAF that may be responsible for mediating transcription by a subset of activators in B cells. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation are infertile due to a granulosa cell defect preventing normal follicle formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	A	G	11: 84,231,748	N331S	probably benign	Het
Adk	A	G	14: 21,318,074	N189S	probably benign	Het
Apc	T	A	18: 34,315,944	N1930K	probably damaging	Het
Arhgap28	T	C	17: 67,864,606	D391G	probably damaging	Het
Atn1	G	T	6: 124,743,371		probably benign	Het
C2cd5	T	C	6: 143,041,490	E471G	probably damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Cap2	T	C	13: 46,560,547	L34P	probably damaging	Het
Cdc42ep2	T	A	19: 5,918,525	M51L	probably benign	Het
Cntn5	C	T	9: 9,972,870	A254T	probably damaging	Het
Dicer1	A	T	12: 104,704,174	L1044H	probably damaging	Het
Dkk3	A	C	7: 112,158,223	M58R	probably damaging	Het
Dpy19l3	G	A	7: 35,752,705	R5W	probably damaging	Het
Dsg1c	C	T	18: 20,283,654	P871S	probably damaging	Het
Dusp1	A	T	17: 26,507,696	S131T	probably benign	Het
Enpp2	C	T	15: 54,882,159	G314R	probably damaging	Het
Fam222b	C	A	11: 78,154,930	P439Q	probably benign	Het
Fastkd2	A	T	1: 63,737,811	I369F	probably benign	Het
Fdps	G	A	3: 89,094,894	S205F	probably damaging	Het
Fmo1	A	T	1: 162,836,204	V252E	possibly damaging	Het
Frmd5	A	G	2: 121,555,574	Y230H	probably damaging	Het
Gal	C	T	19: 3,411,171	V88I	probably benign	Het
Gm38394	A	T	1: 133,656,784	D938E	probably damaging	Het
Gnptab	T	C	10: 88,436,525	I1009T	probably damaging	Het
Idh2	C	T	7: 80,098,257	A232T	probably damaging	Het
Klhdc7a	A	T	4: 139,966,705	D310E	probably benign	Het
Klk4	T	C	7: 43,884,008	M97T	probably benign	Het
Krt82	C	T	15: 101,545,593	V227M	probably damaging	Het
Lpp	T	C	16: 24,761,837	V226A	probably damaging	Het
Mbd1	AGCTGACTCGGTAC	A	18: 74,273,241		probably null	Het
Mcm10	T	C	2: 5,004,154	K335E	possibly damaging	Het
Mpv17l	A	T	16: 13,940,999	I96L	probably benign	Het
Muc6	G	A	7: 141,638,400	S2120F	possibly damaging	Het
Myb	T	C	10: 21,154,712	D62G	possibly damaging	Het
Nasp	A	T	4: 116,610,695	N364K	probably benign	Het
Npsr1	A	G	9: 24,313,277	N317D	probably damaging	Het
Nup210	A	G	6: 91,028,795	V619A	possibly damaging	Het
Oser1	C	T	2: 163,411,396		probably null	Het
Pcdhb4	T	C	18: 37,309,215	F526S	probably damaging	Het
Plekhh3	T	C	11: 101,165,141	N444S	probably damaging	Het
Pnpla5	G	T	15: 84,120,719	L144M	probably damaging	Het
Pou2f2	G	A	7: 25,116,076	Q89*	probably null	Het
Ptprb	A	G	10: 116,350,178	I1713V	probably benign	Het
Ptprd	A	G	4: 76,128,665	Y442H	probably damaging	Het
Rad21	A	T	15: 51,973,863	I152N	possibly damaging	Het
Ralgapa1	A	G	12: 55,677,038	S1568P	probably damaging	Het
Rhag	T	A	17: 40,834,727	V357E	probably damaging	Het
Rnf121	A	T	7: 102,029,117	D174E	possibly damaging	Het
Sdccag3	T	C	2: 26,387,659	E41G	possibly damaging	Het
Sf3b4	T	C	3: 96,172,982	Y16H	probably damaging	Het
Slc1a3	C	T	15: 8,639,135	V449I	probably damaging	Het
Slc20a2	A	G	8: 22,568,393	I648M	probably benign	Het
Slc25a25	T	A	2: 32,417,822	I254F	probably damaging	Het
Slit3	A	G	11: 35,700,282	H1307R	probably damaging	Het
Sorl1	C	A	9: 42,031,909	M890I	probably damaging	Het
Supt16	A	C	14: 52,176,718	M468R	probably benign	Het
Tapt1	T	C	5: 44,218,101		probably null	Het
Tmco3	T	G	8: 13,296,027	C288W	probably damaging	Het
Tpcn2	A	G	7: 145,277,174	Y145H	probably damaging	Het
Ttn	C	T	2: 76,881,717		probably benign	Het
Usb1	G	T	8: 95,345,318	W215C	probably damaging	Het
Usp2	C	G	9: 44,092,750	T305R	probably damaging	Het
Vmn1r13	G	A	6: 57,210,705	S283N	probably benign	Het
Vps54	A	G	11: 21,306,381	K467E	possibly damaging	Het
Wnk2	G	T	13: 49,068,128	S1121Y	probably damaging	Het

Other mutations in Taf4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01658:Taf4b	APN	18	14844420	missense	probably damaging	1.00
IGL01755:Taf4b	APN	18	14897985	missense	probably benign
IGL01755:Taf4b	APN	18	14897986	missense	probably benign	0.13
IGL02049:Taf4b	APN	18	14830139	missense	probably benign	0.00
IGL02650:Taf4b	APN	18	14841983	nonsense	probably null
IGL03078:Taf4b	APN	18	14813554	missense	possibly damaging	0.48
IGL03169:Taf4b	APN	18	14821535	missense	probably damaging	1.00
IGL03261:Taf4b	APN	18	14821528	missense	probably benign
adirondack	UTSW	18	14804578	missense	probably null	0.16
R0266:Taf4b	UTSW	18	14813077	splice site	probably benign
R1015:Taf4b	UTSW	18	14813098	missense	probably damaging	1.00
R1054:Taf4b	UTSW	18	14821473	missense	probably benign	0.00
R1416:Taf4b	UTSW	18	14821427	splice site	probably benign
R1435:Taf4b	UTSW	18	14807409	missense	probably damaging	1.00
R1609:Taf4b	UTSW	18	14835881	missense	probably damaging	1.00
R1611:Taf4b	UTSW	18	14844469	missense	probably null	1.00
R1906:Taf4b	UTSW	18	14822102	missense	probably benign	0.00
R2038:Taf4b	UTSW	18	14807399	missense	probably damaging	1.00
R2890:Taf4b	UTSW	18	14804792	missense	probably damaging	1.00
R4527:Taf4b	UTSW	18	14821442	missense	probably damaging	1.00
R4559:Taf4b	UTSW	18	14813526	missense	probably damaging	1.00
R4773:Taf4b	UTSW	18	14804520	missense	probably benign	0.30
R4857:Taf4b	UTSW	18	14804578	missense	probably null	0.16
R4946:Taf4b	UTSW	18	14813542	missense	probably damaging	1.00
R4984:Taf4b	UTSW	18	14835816	missense	probably damaging	1.00
R4994:Taf4b	UTSW	18	14898043	missense	probably damaging	0.99
R5010:Taf4b	UTSW	18	14822172	missense	possibly damaging	0.59
R5155:Taf4b	UTSW	18	14830095	missense	probably benign	0.07
R5874:Taf4b	UTSW	18	14804554	missense	probably benign
R6079:Taf4b	UTSW	18	14822198	missense	possibly damaging	0.75
R6303:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6304:Taf4b	UTSW	18	14807355	missense	probably damaging	1.00
R6372:Taf4b	UTSW	18	14804733	missense	probably damaging	1.00
R6972:Taf4b	UTSW	18	14813347	missense	possibly damaging	0.86
R7538:Taf4b	UTSW	18	14813545	missense	probably damaging	1.00
R7790:Taf4b	UTSW	18	14813274	missense	probably damaging	1.00
R8021:Taf4b	UTSW	18	14804524	missense	probably damaging	1.00
R8072:Taf4b	UTSW	18	14821528	missense	probably benign
R8075:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8145:Taf4b	UTSW	18	14830028	missense	probably damaging	1.00
R8221:Taf4b	UTSW	18	14898049	missense	probably damaging	1.00
R8320:Taf4b	UTSW	18	14783692	missense	possibly damaging	0.58
R8509:Taf4b	UTSW	18	14898055	missense	probably damaging	1.00
R8535:Taf4b	UTSW	18	14822138	missense	probably damaging	0.99
R8772:Taf4b	UTSW	18	14835852	missense	probably damaging	1.00
R8805:Taf4b	UTSW	18	14813428	missense	possibly damaging	0.65
R8874:Taf4b	UTSW	18	14830070	missense	probably benign	0.39
R9155:Taf4b	UTSW	18	14813239	missense	probably benign	0.00
R9254:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98
R9338:Taf4b	UTSW	18	14821498	missense	probably benign	0.00
R9379:Taf4b	UTSW	18	14813374	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGAATTTCTGGCGCGGAAGCTC -3'
(R):5'- GAAGCTGCAAATTAGCCGGTAGTTG -3'

Sequencing Primer
(F):5'- AACTGAAGTGACGCCCTG -3'
(R):5'- CAAATTAGCCGGTAGTTGGATTG -3'

Posted On

2013-08-08