Incidental Mutation 'R8457:Il1f9'
ID655051
Institutional Source Beutler Lab
Gene Symbol Il1f9
Ensembl Gene ENSMUSG00000044103
Gene Nameinterleukin 1 family, member 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8457 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location24186476-24193568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24188649 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 87 (Y87C)
Ref Sequence ENSEMBL: ENSMUSP00000053391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057567]
Predicted Effect probably benign
Transcript: ENSMUST00000057567
AA Change: Y87C

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053391
Gene: ENSMUSG00000044103
AA Change: Y87C

DomainStartEndE-ValueType
IL1 43 190 7.91e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. The activity of this cytokine is mediated by interleukin 1 receptor-like 2 (IL1RL2/IL1R-rp2), and is specifically inhibited by interleukin 1 family, member 5 (IL1F5/IL-1 delta). Interferon-gamma, tumor necrosis factor-alpha and interleukin 1, beta (IL1B) are reported to stimulate the expression of this cytokine in keratinocytes. The expression of this cytokine in keratinocytes can also be induced by a contact hypersensitivity reaction or herpes simplex virus infection. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Two alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T A 11: 46,140,112 L813Q probably damaging Het
Alpk3 A G 7: 81,093,318 N961S probably damaging Het
Arhgap42 A T 9: 9,016,220 S403T probably benign Het
Cdkl1 T C 12: 69,747,338 T342A probably benign Het
Chd2 T C 7: 73,447,237 E1497G probably damaging Het
Cldn11 T C 3: 31,163,193 V170A probably benign Het
Cps1 T A 1: 67,156,854 F291I probably damaging Het
Cpsf2 T A 12: 102,002,670 S722T probably damaging Het
Creld1 T C 6: 113,491,738 probably null Het
Dgki T A 6: 36,850,956 E1002V possibly damaging Het
Disp3 T A 4: 148,261,115 I423F possibly damaging Het
Dysf T C 6: 84,188,245 V1601A probably benign Het
E4f1 G A 17: 24,446,527 A347V probably benign Het
Epb41l1 G A 2: 156,525,251 R680Q probably benign Het
Fcrl5 T G 3: 87,444,260 S272A probably damaging Het
Gbp7 A T 3: 142,546,372 D572V probably benign Het
Gm21903 A T 17: 39,043,320 F8I unknown Het
Grin2b A G 6: 135,732,199 S1450P probably benign Het
Icos C A 1: 60,993,856 S71R probably damaging Het
Ighv1-13 T A 12: 114,630,832 N51K unknown Het
Ighv1-37 C T 12: 114,896,625 probably benign Het
Irf7 T C 7: 141,263,281 N440D possibly damaging Het
Ivns1abp T A 1: 151,354,010 L150M probably damaging Het
Kif16b A G 2: 142,711,908 I990T probably damaging Het
Kif23 A G 9: 61,927,035 probably null Het
Lca5l T G 16: 96,159,708 K523T possibly damaging Het
Mast3 A G 8: 70,780,441 F1076L probably benign Het
Nek11 A T 9: 105,347,992 I107N probably damaging Het
Nlrp12 T C 7: 3,240,805 H359R probably damaging Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Olfr1495 A T 19: 13,768,357 N5I probably benign Het
Olfr957 A C 9: 39,511,146 N191K probably benign Het
Rnf10 C A 5: 115,272,261 K51N possibly damaging Het
Scap G A 9: 110,381,286 G921D probably benign Het
Slc6a13 G A 6: 121,326,104 probably null Het
Tk2 A T 8: 104,236,818 S140T probably damaging Het
Tmem106b A G 6: 13,084,244 Y249C probably damaging Het
Ttll5 T A 12: 85,876,578 S276R probably damaging Het
Ugt1a7c T C 1: 88,095,356 V79A probably benign Het
Zfp410 T C 12: 84,327,312 V141A possibly damaging Het
Other mutations in Il1f9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Il1f9 APN 2 24192785 missense probably benign 0.06
IGL03190:Il1f9 APN 2 24187260 nonsense probably null
IGL03047:Il1f9 UTSW 2 24192707 missense probably damaging 1.00
R2384:Il1f9 UTSW 2 24192648 missense probably benign 0.43
R5158:Il1f9 UTSW 2 24192786 missense probably damaging 0.99
R5916:Il1f9 UTSW 2 24192794 makesense probably null
R6875:Il1f9 UTSW 2 24188621 critical splice acceptor site probably null
R8187:Il1f9 UTSW 2 24192605 missense probably damaging 1.00
R8357:Il1f9 UTSW 2 24188649 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- CAACAGCTAGGTCAGGATGG -3'
(R):5'- CATGAAACCCACTGCTTTATATGC -3'

Sequencing Primer
(F):5'- CAGCTAGGTCAGGATGGATAGGTG -3'
(R):5'- TTTCTGGGTCACTGACCT -3'
Posted On2020-10-20