Incidental Mutation 'R8457:Disp3'
ID 655057
Institutional Source Beutler Lab
Gene Symbol Disp3
Ensembl Gene ENSMUSG00000041544
Gene Name dispatched RND transporter family member 3
Synonyms G630052C06Rik, Ptchd2
MMRRC Submission 067834-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 148324721-148372422 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 148345572 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 423 (I423F)
Ref Sequence ENSEMBL: ENSMUSP00000038490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047720]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000047720
AA Change: I423F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: I423F

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
Pfam:Patched 362 735 2.2e-21 PFAM
Pfam:MMPL 366 590 3.1e-14 PFAM
Pfam:Sterol-sensing 435 588 1.1e-17 PFAM
Pfam:Patched 1121 1301 1.6e-7 PFAM
transmembrane domain 1314 1333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T A 11: 46,030,939 (GRCm39) L813Q probably damaging Het
Alpk3 A G 7: 80,743,066 (GRCm39) N961S probably damaging Het
Arhgap42 A T 9: 9,016,221 (GRCm39) S403T probably benign Het
Cdkl1 T C 12: 69,794,112 (GRCm39) T342A probably benign Het
Chd2 T C 7: 73,096,985 (GRCm39) E1497G probably damaging Het
Cldn11 T C 3: 31,217,342 (GRCm39) V170A probably benign Het
Cps1 T A 1: 67,196,013 (GRCm39) F291I probably damaging Het
Cpsf2 T A 12: 101,968,929 (GRCm39) S722T probably damaging Het
Creld1 T C 6: 113,468,699 (GRCm39) probably null Het
Dgki T A 6: 36,827,891 (GRCm39) E1002V possibly damaging Het
Dysf T C 6: 84,165,227 (GRCm39) V1601A probably benign Het
E4f1 G A 17: 24,665,501 (GRCm39) A347V probably benign Het
Epb41l1 G A 2: 156,367,171 (GRCm39) R680Q probably benign Het
Fcrl5 T G 3: 87,351,567 (GRCm39) S272A probably damaging Het
Gbp7 A T 3: 142,252,133 (GRCm39) D572V probably benign Het
Gm21903 A T 17: 39,354,211 (GRCm39) F8I unknown Het
Grin2b A G 6: 135,709,197 (GRCm39) S1450P probably benign Het
Icos C A 1: 61,033,015 (GRCm39) S71R probably damaging Het
Ighv1-13 T A 12: 114,594,452 (GRCm39) N51K unknown Het
Ighv1-37 C T 12: 114,860,245 (GRCm39) probably benign Het
Il36g A G 2: 24,078,661 (GRCm39) Y87C probably benign Het
Irf7 T C 7: 140,843,194 (GRCm39) N440D possibly damaging Het
Ivns1abp T A 1: 151,229,761 (GRCm39) L150M probably damaging Het
Kif16b A G 2: 142,553,828 (GRCm39) I990T probably damaging Het
Kif23 A G 9: 61,834,317 (GRCm39) probably null Het
Lca5l T G 16: 95,960,908 (GRCm39) K523T possibly damaging Het
Mast3 A G 8: 71,233,085 (GRCm39) F1076L probably benign Het
Nek11 A T 9: 105,225,191 (GRCm39) I107N probably damaging Het
Nlrp12 T C 7: 3,289,435 (GRCm39) H359R probably damaging Het
Nox3 A G 17: 3,736,198 (GRCm39) S143P probably damaging Het
Or10q12 A T 19: 13,745,721 (GRCm39) N5I probably benign Het
Or8g36 A C 9: 39,422,442 (GRCm39) N191K probably benign Het
Rnf10 C A 5: 115,410,320 (GRCm39) K51N possibly damaging Het
Scap G A 9: 110,210,354 (GRCm39) G921D probably benign Het
Slc6a13 G A 6: 121,303,063 (GRCm39) probably null Het
Tk2 A T 8: 104,963,450 (GRCm39) S140T probably damaging Het
Tmem106b A G 6: 13,084,243 (GRCm39) Y249C probably damaging Het
Ttll5 T A 12: 85,923,352 (GRCm39) S276R probably damaging Het
Ugt1a7c T C 1: 88,023,078 (GRCm39) V79A probably benign Het
Zfp410 T C 12: 84,374,086 (GRCm39) V141A possibly damaging Het
Other mutations in Disp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Disp3 APN 4 148,325,991 (GRCm39) missense probably benign 0.10
IGL01065:Disp3 APN 4 148,345,640 (GRCm39) missense probably damaging 1.00
IGL01800:Disp3 APN 4 148,334,258 (GRCm39) nonsense probably null
IGL01947:Disp3 APN 4 148,344,976 (GRCm39) missense probably damaging 1.00
IGL02510:Disp3 APN 4 148,337,158 (GRCm39) missense probably benign 0.00
IGL02573:Disp3 APN 4 148,355,906 (GRCm39) missense probably damaging 1.00
IGL02728:Disp3 APN 4 148,356,495 (GRCm39) missense probably damaging 1.00
IGL02931:Disp3 APN 4 148,333,658 (GRCm39) missense possibly damaging 0.94
R0164:Disp3 UTSW 4 148,338,708 (GRCm39) missense probably damaging 0.96
R0164:Disp3 UTSW 4 148,338,708 (GRCm39) missense probably damaging 0.96
R0257:Disp3 UTSW 4 148,335,211 (GRCm39) missense possibly damaging 0.87
R0409:Disp3 UTSW 4 148,356,416 (GRCm39) missense probably damaging 1.00
R0557:Disp3 UTSW 4 148,325,861 (GRCm39) missense possibly damaging 0.64
R0576:Disp3 UTSW 4 148,326,047 (GRCm39) missense possibly damaging 0.89
R1495:Disp3 UTSW 4 148,334,282 (GRCm39) missense probably benign 0.00
R1526:Disp3 UTSW 4 148,344,373 (GRCm39) missense probably benign 0.00
R1791:Disp3 UTSW 4 148,325,975 (GRCm39) missense probably damaging 1.00
R1856:Disp3 UTSW 4 148,356,089 (GRCm39) missense probably damaging 1.00
R1987:Disp3 UTSW 4 148,343,210 (GRCm39) missense probably damaging 0.97
R2030:Disp3 UTSW 4 148,344,423 (GRCm39) missense probably damaging 1.00
R2271:Disp3 UTSW 4 148,356,059 (GRCm39) missense possibly damaging 0.87
R2373:Disp3 UTSW 4 148,343,252 (GRCm39) missense probably damaging 1.00
R2566:Disp3 UTSW 4 148,325,880 (GRCm39) missense probably damaging 1.00
R3731:Disp3 UTSW 4 148,337,284 (GRCm39) missense probably benign 0.03
R4359:Disp3 UTSW 4 148,356,389 (GRCm39) missense probably benign 0.03
R4762:Disp3 UTSW 4 148,356,575 (GRCm39) missense probably damaging 1.00
R4950:Disp3 UTSW 4 148,342,583 (GRCm39) missense possibly damaging 0.94
R4975:Disp3 UTSW 4 148,328,673 (GRCm39) missense possibly damaging 0.79
R5218:Disp3 UTSW 4 148,327,333 (GRCm39) missense possibly damaging 0.88
R5523:Disp3 UTSW 4 148,342,554 (GRCm39) missense probably benign 0.14
R5556:Disp3 UTSW 4 148,342,614 (GRCm39) missense probably benign 0.14
R5857:Disp3 UTSW 4 148,333,640 (GRCm39) missense probably benign 0.01
R5933:Disp3 UTSW 4 148,325,770 (GRCm39) nonsense probably null
R5994:Disp3 UTSW 4 148,338,741 (GRCm39) missense possibly damaging 0.94
R6362:Disp3 UTSW 4 148,338,765 (GRCm39) missense possibly damaging 0.95
R6813:Disp3 UTSW 4 148,344,387 (GRCm39) missense probably benign 0.09
R7211:Disp3 UTSW 4 148,325,979 (GRCm39) missense probably damaging 0.98
R7470:Disp3 UTSW 4 148,345,527 (GRCm39) missense possibly damaging 0.88
R7535:Disp3 UTSW 4 148,327,323 (GRCm39) missense probably damaging 0.99
R8093:Disp3 UTSW 4 148,354,973 (GRCm39) missense possibly damaging 0.93
R8357:Disp3 UTSW 4 148,345,572 (GRCm39) missense possibly damaging 0.86
R8506:Disp3 UTSW 4 148,326,027 (GRCm39) missense possibly damaging 0.77
R9182:Disp3 UTSW 4 148,354,841 (GRCm39) missense probably damaging 1.00
R9219:Disp3 UTSW 4 148,334,317 (GRCm39) missense possibly damaging 0.74
R9680:Disp3 UTSW 4 148,356,101 (GRCm39) missense probably damaging 1.00
R9696:Disp3 UTSW 4 148,345,611 (GRCm39) missense probably damaging 0.97
Z1088:Disp3 UTSW 4 148,356,200 (GRCm39) missense possibly damaging 0.63
Z1176:Disp3 UTSW 4 148,335,414 (GRCm39) missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148,335,171 (GRCm39) missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148,334,304 (GRCm39) missense probably benign 0.01
Z1177:Disp3 UTSW 4 148,334,203 (GRCm39) missense probably damaging 1.00
Z1177:Disp3 UTSW 4 148,355,024 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATTTGGCCCAGCTCTAAGG -3'
(R):5'- CGCTGATTACTATCTGTGTCGAATG -3'

Sequencing Primer
(F):5'- TCTAAGGAACCAGATTCAGGGCTATC -3'
(R):5'- TACACGTTGAATCACCTGGG -3'
Posted On 2020-10-20