Incidental Mutation 'R8457:Alpk3'
ID 655067
Institutional Source Beutler Lab
Gene Symbol Alpk3
Ensembl Gene ENSMUSG00000038763
Gene Name alpha-kinase 3
Synonyms Midori
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock # R8457 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 81057600-81105612 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81093318 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 961 (N961S)
Ref Sequence ENSEMBL: ENSMUSP00000102971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107348]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000107348
AA Change: N961S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: N961S

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
IGc2 89 159 2.78e-11 SMART
low complexity region 183 192 N/A INTRINSIC
low complexity region 400 427 N/A INTRINSIC
low complexity region 514 532 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
low complexity region 1048 1058 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
IG_like 1264 1330 5.73e-2 SMART
low complexity region 1350 1359 N/A INTRINSIC
Alpha_kinase 1395 1592 1.17e-44 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T A 11: 46,140,112 L813Q probably damaging Het
Arhgap42 A T 9: 9,016,220 S403T probably benign Het
Cdkl1 T C 12: 69,747,338 T342A probably benign Het
Chd2 T C 7: 73,447,237 E1497G probably damaging Het
Cldn11 T C 3: 31,163,193 V170A probably benign Het
Cps1 T A 1: 67,156,854 F291I probably damaging Het
Cpsf2 T A 12: 102,002,670 S722T probably damaging Het
Creld1 T C 6: 113,491,738 probably null Het
Dgki T A 6: 36,850,956 E1002V possibly damaging Het
Disp3 T A 4: 148,261,115 I423F possibly damaging Het
Dysf T C 6: 84,188,245 V1601A probably benign Het
E4f1 G A 17: 24,446,527 A347V probably benign Het
Epb41l1 G A 2: 156,525,251 R680Q probably benign Het
Fcrl5 T G 3: 87,444,260 S272A probably damaging Het
Gbp7 A T 3: 142,546,372 D572V probably benign Het
Gm21903 A T 17: 39,043,320 F8I unknown Het
Grin2b A G 6: 135,732,199 S1450P probably benign Het
Icos C A 1: 60,993,856 S71R probably damaging Het
Ighv1-13 T A 12: 114,630,832 N51K unknown Het
Ighv1-37 C T 12: 114,896,625 probably benign Het
Il1f9 A G 2: 24,188,649 Y87C probably benign Het
Irf7 T C 7: 141,263,281 N440D possibly damaging Het
Ivns1abp T A 1: 151,354,010 L150M probably damaging Het
Kif16b A G 2: 142,711,908 I990T probably damaging Het
Kif23 A G 9: 61,927,035 probably null Het
Lca5l T G 16: 96,159,708 K523T possibly damaging Het
Mast3 A G 8: 70,780,441 F1076L probably benign Het
Nek11 A T 9: 105,347,992 I107N probably damaging Het
Nlrp12 T C 7: 3,240,805 H359R probably damaging Het
Nox3 A G 17: 3,685,923 S143P probably damaging Het
Olfr1495 A T 19: 13,768,357 N5I probably benign Het
Olfr957 A C 9: 39,511,146 N191K probably benign Het
Rnf10 C A 5: 115,272,261 K51N possibly damaging Het
Scap G A 9: 110,381,286 G921D probably benign Het
Slc6a13 G A 6: 121,326,104 probably null Het
Tk2 A T 8: 104,236,818 S140T probably damaging Het
Tmem106b A G 6: 13,084,244 Y249C probably damaging Het
Ttll5 T A 12: 85,876,578 S276R probably damaging Het
Ugt1a7c T C 1: 88,095,356 V79A probably benign Het
Zfp410 T C 12: 84,327,312 V141A possibly damaging Het
Other mutations in Alpk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Alpk3 APN 7 81078009 missense possibly damaging 0.95
IGL00472:Alpk3 APN 7 81095653 splice site probably benign
IGL01732:Alpk3 APN 7 81057642 missense unknown
IGL01750:Alpk3 APN 7 81092282 missense probably damaging 1.00
IGL01812:Alpk3 APN 7 81100202 missense probably damaging 1.00
IGL02224:Alpk3 APN 7 81076868 splice site probably benign
IGL02292:Alpk3 APN 7 81077905 missense possibly damaging 0.46
IGL02340:Alpk3 APN 7 81078507 missense probably benign 0.03
IGL02517:Alpk3 APN 7 81077895 missense probably benign 0.00
IGL02725:Alpk3 APN 7 81093610 missense possibly damaging 0.91
IGL02755:Alpk3 APN 7 81093759 missense possibly damaging 0.71
IGL03035:Alpk3 APN 7 81078604 missense probably benign 0.00
IGL03102:Alpk3 APN 7 81095056 critical splice donor site probably null
IGL03153:Alpk3 APN 7 81093395 missense probably benign 0.00
IGL03255:Alpk3 APN 7 81092562 missense probably benign 0.01
IGL03367:Alpk3 APN 7 81094990 missense probably benign 0.01
FR4304:Alpk3 UTSW 7 81077762 small insertion probably benign
FR4737:Alpk3 UTSW 7 81077762 small insertion probably benign
IGL03097:Alpk3 UTSW 7 81093909 missense probably benign 0.00
R0092:Alpk3 UTSW 7 81092553 missense probably benign
R0254:Alpk3 UTSW 7 81076974 missense probably benign 0.43
R0310:Alpk3 UTSW 7 81078610 missense possibly damaging 0.61
R0325:Alpk3 UTSW 7 81067953 missense possibly damaging 0.58
R0387:Alpk3 UTSW 7 81104227 missense possibly damaging 0.93
R0971:Alpk3 UTSW 7 81092579 missense possibly damaging 0.55
R1078:Alpk3 UTSW 7 81078600 missense probably benign
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1168:Alpk3 UTSW 7 81103357 missense probably damaging 1.00
R1306:Alpk3 UTSW 7 81093873 missense probably damaging 1.00
R1822:Alpk3 UTSW 7 81076931 nonsense probably null
R2173:Alpk3 UTSW 7 81076900 missense probably damaging 1.00
R2350:Alpk3 UTSW 7 81094970 missense probably damaging 1.00
R2414:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2417:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2885:Alpk3 UTSW 7 81100192 missense probably damaging 1.00
R3004:Alpk3 UTSW 7 81103355 nonsense probably null
R3796:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3797:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3798:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3799:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3894:Alpk3 UTSW 7 81078390 missense possibly damaging 0.93
R4395:Alpk3 UTSW 7 81094955 missense probably damaging 1.00
R4761:Alpk3 UTSW 7 81104168 missense probably damaging 0.99
R5505:Alpk3 UTSW 7 81078561 missense possibly damaging 0.87
R5540:Alpk3 UTSW 7 81095436 missense probably damaging 1.00
R5770:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R5941:Alpk3 UTSW 7 81078653 missense probably damaging 1.00
R5964:Alpk3 UTSW 7 81092260 missense possibly damaging 0.88
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6066:Alpk3 UTSW 7 81076950 missense possibly damaging 0.89
R6517:Alpk3 UTSW 7 81078579 missense possibly damaging 0.54
R6578:Alpk3 UTSW 7 81078684 missense probably benign 0.00
R7230:Alpk3 UTSW 7 81093294 missense probably damaging 1.00
R7266:Alpk3 UTSW 7 81092580 missense possibly damaging 0.55
R7271:Alpk3 UTSW 7 81078454 missense possibly damaging 0.92
R7402:Alpk3 UTSW 7 81076912 missense probably benign 0.29
R7411:Alpk3 UTSW 7 81092852 missense probably benign 0.11
R7454:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R7468:Alpk3 UTSW 7 81100998 nonsense probably null
R7940:Alpk3 UTSW 7 81093945 missense probably damaging 1.00
R8157:Alpk3 UTSW 7 81093722 missense probably benign 0.00
R8246:Alpk3 UTSW 7 81092776 missense probably benign 0.00
R8357:Alpk3 UTSW 7 81093318 missense probably damaging 1.00
R8444:Alpk3 UTSW 7 81057720 missense probably benign 0.08
R8775:Alpk3 UTSW 7 81077850 missense probably benign 0.00
R8775-TAIL:Alpk3 UTSW 7 81077850 missense probably benign 0.00
R8794:Alpk3 UTSW 7 81057655 missense unknown
R8982:Alpk3 UTSW 7 81099002 missense probably damaging 1.00
R9259:Alpk3 UTSW 7 81093554 missense probably damaging 1.00
RF034:Alpk3 UTSW 7 81092414 small deletion probably benign
RF057:Alpk3 UTSW 7 81092417 frame shift probably null
X0022:Alpk3 UTSW 7 81093897 missense probably damaging 0.96
Z1176:Alpk3 UTSW 7 81078626 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGTCTGCAGGAGGAGCTAC -3'
(R):5'- AAGTGATTGTTCTCCACGCG -3'

Sequencing Primer
(F):5'- GACCAGGACTTTCCGAGTTC -3'
(R):5'- ACGCGTTCCAGGATTCG -3'
Posted On 2020-10-20