Incidental Mutation 'R0386:Tbk1'
ID65507
Institutional Source Beutler Lab
Gene Symbol Tbk1
Ensembl Gene ENSMUSG00000020115
Gene NameTANK-binding kinase 1
Synonyms1200008B05Rik
MMRRC Submission 038592-MU
Accession Numbers

MGI: 1929658

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0386 (G1)
Quality Score157
Status Validated
Chromosome10
Chromosomal Location121546455-121586787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121584254 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 10 (L10P)
Ref Sequence ENSEMBL: ENSMUSP00000151440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020316] [ENSMUST00000039810] [ENSMUST00000218004] [ENSMUST00000219400] [ENSMUST00000219493]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020316
AA Change: L10P

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020316
Gene: ENSMUSG00000020115
AA Change: L10P

DomainStartEndE-ValueType
Pfam:Pkinase 9 300 2.6e-46 PFAM
Pfam:Pkinase_Tyr 10 250 1.5e-27 PFAM
low complexity region 355 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039810
SMART Domains Protein: ENSMUSP00000043488
Gene: ENSMUSG00000034667

DomainStartEndE-ValueType
IBN_N 21 89 1.37e-3 SMART
Pfam:Xpo1 98 248 5.1e-42 PFAM
low complexity region 386 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218004
Predicted Effect probably damaging
Transcript: ENSMUST00000219400
AA Change: L10P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000219493
Meta Mutation Damage Score 0.0891 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality. Mice homozygous for a different knock-out allele exhibit increased prenatal lethality, increased infiltration of mononuclear and/or granulomatous cells in multiple organs and tissues at 3 months of age, and increased lethality in response to LPS. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(5) Gene trapped(18)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A G 5: 76,896,461 V194A probably damaging Het
Adamts13 G A 2: 26,986,679 probably null Het
Ahnak T C 19: 9,011,144 M3264T possibly damaging Het
Birc6 T A 17: 74,599,340 C1409S probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Dnah2 A G 11: 69,447,861 V3161A probably damaging Het
Dnah5 A T 15: 28,383,581 Y2983F probably damaging Het
Dnah6 G A 6: 73,083,124 L2774F probably damaging Het
Dst A T 1: 34,217,836 T4398S probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
Efcab5 A T 11: 77,172,378 M96K probably benign Het
Elavl4 A G 4: 110,206,705 probably benign Het
Flt4 G A 11: 49,644,386 A1214T probably benign Het
Fn1 G T 1: 71,595,786 T2127N probably damaging Het
Foxj1 A T 11: 116,331,803 S391R possibly damaging Het
Gabrb1 A T 5: 72,108,807 Y269F probably damaging Het
Ghitm A G 14: 37,125,911 S259P possibly damaging Het
Gm16332 A G 1: 139,924,190 noncoding transcript Het
Gm16380 T A 9: 53,884,443 noncoding transcript Het
Gm9869 A T 9: 60,838,062 probably benign Het
Gm9936 G A 5: 114,857,131 Q142* probably null Het
Hmbs T C 9: 44,337,008 Y260C probably benign Het
Hoxc5 T A 15: 103,015,352 C193* probably null Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Lce1j T C 3: 92,789,388 K28E unknown Het
Lpgat1 C T 1: 191,719,348 probably benign Het
Lyst T C 13: 13,708,214 probably benign Het
Megf11 A G 9: 64,640,078 N235D probably damaging Het
Mst1r T A 9: 107,916,804 probably null Het
Nr2c2ap A G 8: 70,131,587 D9G probably benign Het
Obscn T C 11: 59,136,339 T13A probably damaging Het
Ofcc1 A C 13: 40,214,474 L188* probably null Het
Olfr1028 A G 2: 85,951,873 E270G probably damaging Het
Olfr432 A T 1: 174,050,399 T9S probably benign Het
Oma1 A T 4: 103,325,201 probably benign Het
Pcm1 T C 8: 41,316,023 F1642S probably damaging Het
Pglyrp2 A G 17: 32,420,862 M1T probably null Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Prdm10 C A 9: 31,316,300 T67K probably damaging Het
Ralgapa1 A T 12: 55,708,067 H1193Q probably benign Het
Sall1 A G 8: 89,032,604 S291P probably damaging Het
Sdk2 T C 11: 113,893,464 T150A probably damaging Het
Sel1l2 T A 2: 140,275,441 Y170F probably benign Het
Sema4a C T 3: 88,436,800 V715I possibly damaging Het
Smgc G A 15: 91,854,638 A500T probably benign Het
Spef2 A G 15: 9,584,062 V1639A probably damaging Het
Srrm4 A G 5: 116,482,378 probably benign Het
Tbc1d23 G A 16: 57,189,273 H418Y probably damaging Het
Thumpd3 G A 6: 113,065,660 probably null Het
Trp53bp1 G T 2: 121,204,943 T1609K probably damaging Het
Tut1 A G 19: 8,955,555 N84S probably benign Het
Urb1 C T 16: 90,796,399 G282R probably damaging Het
Usp19 A T 9: 108,499,711 D1160V probably damaging Het
Usp9y A G Y: 1,316,933 V1872A probably damaging Het
Zfp276 C A 8: 123,259,503 Y386* probably null Het
Other mutations in Tbk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Tbk1 APN 10 121552250 missense probably benign 0.00
IGL01021:Tbk1 APN 10 121551272 missense probably benign 0.07
IGL01371:Tbk1 APN 10 121559871 missense probably benign 0.09
IGL01383:Tbk1 APN 10 121576279 missense probably damaging 1.00
IGL01583:Tbk1 APN 10 121557229 missense probably benign
IGL01734:Tbk1 APN 10 121571983 nonsense probably null
IGL02068:Tbk1 APN 10 121570789 missense probably damaging 1.00
IGL02676:Tbk1 APN 10 121568080 missense possibly damaging 0.82
IGL02737:Tbk1 APN 10 121559862 missense probably null 0.96
IGL03334:Tbk1 APN 10 121584199 missense possibly damaging 0.79
Pathfinder UTSW 10 121552501 missense probably damaging 0.98
pioneer UTSW 10 121578690 missense probably damaging 1.00
trailblazer UTSW 10 121570685 missense probably damaging 1.00
BB006:Tbk1 UTSW 10 121557233 missense probably benign 0.00
BB016:Tbk1 UTSW 10 121557233 missense probably benign 0.00
R0030:Tbk1 UTSW 10 121561624 missense probably benign 0.09
R1396:Tbk1 UTSW 10 121571916 missense probably damaging 1.00
R1430:Tbk1 UTSW 10 121559934 missense probably benign
R1522:Tbk1 UTSW 10 121551318 missense probably benign 0.06
R1542:Tbk1 UTSW 10 121559935 missense probably benign
R1717:Tbk1 UTSW 10 121561645 missense probably benign 0.10
R1860:Tbk1 UTSW 10 121547171 missense probably benign 0.01
R2188:Tbk1 UTSW 10 121563931 nonsense probably null
R2519:Tbk1 UTSW 10 121557259 missense probably benign 0.03
R4627:Tbk1 UTSW 10 121568080 missense possibly damaging 0.82
R4945:Tbk1 UTSW 10 121551269 missense probably damaging 0.98
R5061:Tbk1 UTSW 10 121576336 missense possibly damaging 0.62
R5256:Tbk1 UTSW 10 121570685 missense probably damaging 1.00
R5310:Tbk1 UTSW 10 121556051 missense probably benign 0.00
R6187:Tbk1 UTSW 10 121584243 missense probably benign 0.02
R6425:Tbk1 UTSW 10 121563962 missense probably benign 0.00
R6512:Tbk1 UTSW 10 121578621 missense probably damaging 1.00
R6897:Tbk1 UTSW 10 121559877 missense probably benign 0.00
R7268:Tbk1 UTSW 10 121552499 missense probably benign 0.03
R7609:Tbk1 UTSW 10 121552501 missense probably damaging 0.98
R7860:Tbk1 UTSW 10 121552246 missense possibly damaging 0.55
R7929:Tbk1 UTSW 10 121557233 missense probably benign 0.00
R8378:Tbk1 UTSW 10 121578692 missense probably damaging 0.96
X0022:Tbk1 UTSW 10 121560293 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGCTCCTTTTAAACTCTGGGCATC -3'
(R):5'- TGCTGTATTGCTGGGAACATACTGC -3'

Sequencing Primer
(F):5'- CTAGCACCACTAGGTAGGTGTTC -3'
(R):5'- GCTGGGAACATACTGCATTTC -3'
Posted On2013-08-08