Mutagenetix > Incidental Mutation

Incidental Mutation 'R8457:Adam19'

655076

Institutional Source

Beutler Lab

Gene Symbol

Adam19

Ensembl Gene

ENSMUSG00000011256

Gene Name

a disintegrin and metallopeptidase domain 19 (meltrin beta)

Synonyms

Mltnb

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8457 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

46055992-46147343 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46140112 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 813 (L813Q)

Ref Sequence

ENSEMBL: ENSMUSP00000011400 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011400]

AlphaFold

O35674

Predicted Effect

probably damaging
Transcript: ENSMUST00000011400
AA Change: L813Q

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256
AA Change: L813Q

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Pep_M12B_propep	32	163	9.4e-27	PFAM
Pfam:Reprolysin_5	209	388	1.9e-25	PFAM
Pfam:Reprolysin_4	209	399	1.5e-15	PFAM
Pfam:Reprolysin	211	409	1.3e-68	PFAM
Pfam:Reprolysin_2	231	399	6.1e-19	PFAM
Pfam:Reprolysin_3	235	357	1.2e-19	PFAM
DISIN	426	501	9.7e-41	SMART
ACR	502	650	7.46e-62	SMART
transmembrane domain	704	726	N/A	INTRINSIC
low complexity region	788	797	N/A	INTRINSIC
low complexity region	832	846	N/A	INTRINSIC
low complexity region	886	905	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a cell surface glycoprotein and member of the ADAM (a disintegrin and metalloproteinase) family of endopeptidases. The encoded protein may play a role in the ectodomain shedding of neuregulin proteins. Homozygous knockout mice for this gene exhibit heart development defects and perinatal lethality. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that undergoes proteolytic processing to generate a mature protein product. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice exhibit cardiac developmental defects and die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alpk3	A	G	7: 81,093,318	N961S	probably damaging	Het
Arhgap42	A	T	9: 9,016,220	S403T	probably benign	Het
Cdkl1	T	C	12: 69,747,338	T342A	probably benign	Het
Chd2	T	C	7: 73,447,237	E1497G	probably damaging	Het
Cldn11	T	C	3: 31,163,193	V170A	probably benign	Het
Cps1	T	A	1: 67,156,854	F291I	probably damaging	Het
Cpsf2	T	A	12: 102,002,670	S722T	probably damaging	Het
Creld1	T	C	6: 113,491,738		probably null	Het
Dgki	T	A	6: 36,850,956	E1002V	possibly damaging	Het
Disp3	T	A	4: 148,261,115	I423F	possibly damaging	Het
Dysf	T	C	6: 84,188,245	V1601A	probably benign	Het
E4f1	G	A	17: 24,446,527	A347V	probably benign	Het
Epb41l1	G	A	2: 156,525,251	R680Q	probably benign	Het
Fcrl5	T	G	3: 87,444,260	S272A	probably damaging	Het
Gbp7	A	T	3: 142,546,372	D572V	probably benign	Het
Gm21903	A	T	17: 39,043,320	F8I	unknown	Het
Grin2b	A	G	6: 135,732,199	S1450P	probably benign	Het
Icos	C	A	1: 60,993,856	S71R	probably damaging	Het
Ighv1-13	T	A	12: 114,630,832	N51K	unknown	Het
Ighv1-37	C	T	12: 114,896,625		probably benign	Het
Il1f9	A	G	2: 24,188,649	Y87C	probably benign	Het
Irf7	T	C	7: 141,263,281	N440D	possibly damaging	Het
Ivns1abp	T	A	1: 151,354,010	L150M	probably damaging	Het
Kif16b	A	G	2: 142,711,908	I990T	probably damaging	Het
Kif23	A	G	9: 61,927,035		probably null	Het
Lca5l	T	G	16: 96,159,708	K523T	possibly damaging	Het
Mast3	A	G	8: 70,780,441	F1076L	probably benign	Het
Nek11	A	T	9: 105,347,992	I107N	probably damaging	Het
Nlrp12	T	C	7: 3,240,805	H359R	probably damaging	Het
Nox3	A	G	17: 3,685,923	S143P	probably damaging	Het
Olfr1495	A	T	19: 13,768,357	N5I	probably benign	Het
Olfr957	A	C	9: 39,511,146	N191K	probably benign	Het
Rnf10	C	A	5: 115,272,261	K51N	possibly damaging	Het
Scap	G	A	9: 110,381,286	G921D	probably benign	Het
Slc6a13	G	A	6: 121,326,104		probably null	Het
Tk2	A	T	8: 104,236,818	S140T	probably damaging	Het
Tmem106b	A	G	6: 13,084,244	Y249C	probably damaging	Het
Ttll5	T	A	12: 85,876,578	S276R	probably damaging	Het
Ugt1a7c	T	C	1: 88,095,356	V79A	probably benign	Het
Zfp410	T	C	12: 84,327,312	V141A	possibly damaging	Het

Other mutations in Adam19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01433:Adam19	APN	11	46112783	missense	probably damaging	1.00
IGL01727:Adam19	APN	11	46121553	missense	probably benign
IGL01758:Adam19	APN	11	46112924	missense	probably benign	0.01
IGL02160:Adam19	APN	11	46139695	missense	probably damaging	0.99
IGL02421:Adam19	APN	11	46137553	missense	probably damaging	0.96
IGL02572:Adam19	APN	11	46131721	nonsense	probably null
IGL02995:Adam19	APN	11	46136349	missense	probably benign	0.00
IGL03171:Adam19	APN	11	46138854	missense	probably damaging	0.98
IGL03237:Adam19	APN	11	46137556	missense	probably benign
R0003:Adam19	UTSW	11	46128789	missense	probably damaging	1.00
R0026:Adam19	UTSW	11	46136259	missense	probably damaging	1.00
R0158:Adam19	UTSW	11	46143034	missense	probably damaging	1.00
R0304:Adam19	UTSW	11	46127392	missense	possibly damaging	0.91
R0488:Adam19	UTSW	11	46138930	missense	probably damaging	0.98
R0501:Adam19	UTSW	11	46123130	missense	probably damaging	1.00
R0591:Adam19	UTSW	11	46121411	splice site	probably benign
R0734:Adam19	UTSW	11	46127403	missense	probably damaging	0.99
R0747:Adam19	UTSW	11	46118495	splice site	probably null
R0771:Adam19	UTSW	11	46121453	missense	possibly damaging	0.92
R1052:Adam19	UTSW	11	46127265	missense	probably damaging	0.99
R1573:Adam19	UTSW	11	46113618	splice site	probably benign
R1735:Adam19	UTSW	11	46138917	missense	probably benign	0.26
R1830:Adam19	UTSW	11	46127278	missense	probably damaging	0.98
R1911:Adam19	UTSW	11	46121454	missense	probably damaging	1.00
R2092:Adam19	UTSW	11	46060904	splice site	probably null
R3749:Adam19	UTSW	11	46137610	missense	probably benign	0.00
R3893:Adam19	UTSW	11	46128838	missense	probably damaging	1.00
R3916:Adam19	UTSW	11	46060935	missense	probably benign	0.25
R3917:Adam19	UTSW	11	46060935	missense	probably benign	0.25
R4506:Adam19	UTSW	11	46118444	missense	possibly damaging	0.67
R4767:Adam19	UTSW	11	46138977	critical splice donor site	probably null
R5055:Adam19	UTSW	11	46123169	missense	probably damaging	1.00
R5313:Adam19	UTSW	11	46131776	missense	probably damaging	1.00
R5329:Adam19	UTSW	11	46125026	missense	probably damaging	0.99
R5567:Adam19	UTSW	11	46136250	missense	probably damaging	1.00
R5602:Adam19	UTSW	11	46136315	missense	probably benign
R6198:Adam19	UTSW	11	46121502	missense	probably damaging	1.00
R6875:Adam19	UTSW	11	46112875	missense	probably benign
R7011:Adam19	UTSW	11	46143018	missense	probably benign	0.00
R7163:Adam19	UTSW	11	46131717	missense	probably benign
R7213:Adam19	UTSW	11	46121471	missense	probably benign	0.20
R7267:Adam19	UTSW	11	46121576	nonsense	probably null
R7896:Adam19	UTSW	11	46137543	missense	probably damaging	1.00
R8012:Adam19	UTSW	11	46065046	missense	possibly damaging	0.74
R8059:Adam19	UTSW	11	46136466	splice site	probably benign
R8243:Adam19	UTSW	11	46125082	missense	probably damaging	1.00
R8357:Adam19	UTSW	11	46140112	missense	probably damaging	0.96
R8419:Adam19	UTSW	11	46125023	missense	possibly damaging	0.77
R9163:Adam19	UTSW	11	46127349	missense	probably benign	0.02
R9349:Adam19	UTSW	11	46131743	nonsense	probably null
R9489:Adam19	UTSW	11	46137622	missense	probably benign	0.10
X0067:Adam19	UTSW	11	46056115	start codon destroyed	probably null	0.06

Predicted Primers

PCR Primer
(F):5'- GAATCCAAAGGTCAGCATGTC -3'
(R):5'- TCAGTGCATCACATCAACGC -3'

Sequencing Primer
(F):5'- GCATGTCTGAAAGTCACCTCATTGAG -3'
(R):5'- CTCATTGCTGATGGCCTGCTATG -3'

Posted On

2020-10-20