Mutagenetix > Incidental Mutation

Incidental Mutation 'R8458:Dnah14'

655092

Institutional Source

Beutler Lab

Gene Symbol

Dnah14

Ensembl Gene

ENSMUSG00000047369

Gene Name

dynein, axonemal, heavy chain 14

Synonyms

Dnahc14, Gm980, LOC381311, A230079K17Rik

MMRRC Submission

067835-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R8458 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

181576559-181815774 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 181806012 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Proline at position 4 (H4P)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000208001]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000192602

Predicted Effect

probably benign
Transcript: ENSMUST00000208001
AA Change: H4290P

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts20	T	A	15: 94,353,640	H422L	probably benign	Het
Adgra3	G	T	5: 49,987,671	P527T	probably damaging	Het
Afg1l	A	G	10: 42,426,521	V161A	probably damaging	Het
Als2cl	A	C	9: 110,884,957	E65A	probably damaging	Het
Arl3	A	C	19: 46,558,270	S39A	probably benign	Het
Cacna1a	T	C	8: 84,549,458	V560A	probably damaging	Het
Ccr10	C	T	11: 101,174,156	G183R	probably damaging	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Chkb	A	T	15: 89,428,173	V213E	possibly damaging	Het
Chst5	A	G	8: 111,890,790	V66A	probably damaging	Het
Crx	C	A	7: 15,868,106	A216S	possibly damaging	Het
Ctnnd1	T	C	2: 84,613,943	D556G	probably damaging	Het
Cyp4a14	C	A	4: 115,495,932	G61V	probably damaging	Het
Cyp4f17	T	A	17: 32,520,576	F157L	probably damaging	Het
Dnah12	A	T	14: 26,826,892		probably null	Het
Dnah7a	T	C	1: 53,617,983	D878G	probably benign	Het
Epb41l1	C	T	2: 156,521,764	T731I	probably benign	Het
Epg5	G	C	18: 77,948,731	E214D	probably benign	Het
Fam171b	A	G	2: 83,860,520	T276A	probably benign	Het
Fat4	G	A	3: 38,981,553	R3118H	probably benign	Het
Fbrs	C	T	7: 127,483,157	R327W	probably damaging	Het
Fmo3	A	G	1: 162,966,940	V187A	possibly damaging	Het
Gins1	T	C	2: 150,930,887	V190A	probably benign	Het
Gm17067	T	C	7: 42,708,731	S116G	probably damaging	Het
Gm5478	A	G	15: 101,645,427	V250A	probably benign	Het
Gpr85	T	C	6: 13,836,849	T19A	probably benign	Het
Hepacam2	T	C	6: 3,483,358	N217S	probably damaging	Het
Igf1r	T	C	7: 68,195,629	Y889H	probably benign	Het
Itpr2	T	G	6: 146,233,966	R1822S	possibly damaging	Het
Kcnk7	C	T	19: 5,704,379		probably benign	Het
Klk1	T	C	7: 44,225,509	S11P	probably damaging	Het
Klra7	C	T	6: 130,224,146	G216R	probably damaging	Het
Krt34	T	C	11: 100,040,075	D167G	probably damaging	Het
Larp1b	A	C	3: 40,976,560	E291D	probably benign	Het
Lats1	T	A	10: 7,710,924	L950*	probably null	Het
Lrrc2	A	C	9: 110,970,150	D255A	probably damaging	Het
Lrrc49	A	T	9: 60,598,173	M605K	probably benign	Het
Mocos	A	G	18: 24,666,257	K183E	probably benign	Het
Mpl	C	A	4: 118,444,016		probably null	Het
Mroh9	T	A	1: 163,055,681	T410S	probably damaging	Het
Notch3	T	C	17: 32,156,050	E430G	probably damaging	Het
Nsun6	T	C	2: 15,030,052	T252A	probably benign	Het
Ntrk1	C	A	3: 87,791,669		probably null	Het
Nts	G	T	10: 102,485,060	T56N	probably damaging	Het
Nup210l	A	G	3: 90,185,567	D1276G	probably null	Het
Olfr1255	G	T	2: 89,817,150	V269F	probably damaging	Het
Olfr1458	T	C	19: 13,102,476	Y276C	probably damaging	Het
Olfr642	C	A	7: 104,049,668	A229S	possibly damaging	Het
Osbpl8	A	G	10: 111,277,316	S535G	possibly damaging	Het
Pax9	A	G	12: 56,696,765	I66V	possibly damaging	Het
Pja2	A	G	17: 64,292,848	V547A	probably damaging	Het
Plekhs1	T	C	19: 56,477,158	L185S	probably benign	Het
Prkdc	T	A	16: 15,790,676		probably null	Het
Ptgdr2	A	T	19: 10,940,421	T101S	possibly damaging	Het
Ptprd	T	C	4: 76,066,259	D550G	probably benign	Het
Ptx3	G	T	3: 66,220,998	R160L	probably benign	Het
Rdh16f1	A	C	10: 127,788,845	E184A	probably damaging	Het
Rfx3	C	T	19: 27,793,672	E560K	possibly damaging	Het
Scgb2b24	T	C	7: 33,737,354	Q111R	probably benign	Het
Spg20	A	G	3: 55,124,894	D383G	probably damaging	Het
Stpg3	C	A	2: 25,213,321	R252L	probably damaging	Het
Tcp11l2	C	T	10: 84,613,532	Q454*	probably null	Het
Trav10d	A	G	14: 52,811,323	Y57C	probably damaging	Het
Vmn1r170	T	A	7: 23,606,896	M241K	possibly damaging	Het
Vwa8	T	A	14: 79,064,892	N1000K	probably damaging	Het
Wdsub1	T	C	2: 59,861,701	E329G	probably benign	Het
Wnk4	C	A	11: 101,275,321	C891*	probably null	Het
Zdhhc16	G	T	19: 41,939,654	C204F	probably damaging	Het
Zfp868	T	C	8: 69,611,908	I259V	possibly damaging	Het
Zranb3	G	T	1: 127,992,910	Q426K	probably damaging	Het

Other mutations in Dnah14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Dnah14	APN	1	181752046	missense	probably benign	0.17
IGL01764:Dnah14	APN	1	181744777	missense	probably benign	0.00
IGL03218:Dnah14	APN	1	181755269	missense	probably benign	0.02
IGL03290:Dnah14	APN	1	181763978	splice site	probably benign
IGL03384:Dnah14	APN	1	181745949	missense	probably benign	0.03
R0009:Dnah14	UTSW	1	181769407	splice site	probably benign
R0125:Dnah14	UTSW	1	181752063	missense	probably damaging	0.99
R0579:Dnah14	UTSW	1	181744747	missense	possibly damaging	0.72
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0973:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R0974:Dnah14	UTSW	1	181752145	missense	probably damaging	1.00
R1609:Dnah14	UTSW	1	181750177	missense	probably damaging	0.97
R1860:Dnah14	UTSW	1	181763960	missense	probably damaging	1.00
R2050:Dnah14	UTSW	1	181752562	missense	probably damaging	1.00
R2974:Dnah14	UTSW	1	181755241	critical splice acceptor site	probably null
R4715:Dnah14	UTSW	1	181757223	missense	probably damaging	1.00
R5076:Dnah14	UTSW	1	181757234	missense	probably benign	0.01
R5424:Dnah14	UTSW	1	181763310	missense	possibly damaging	0.95
R5808:Dnah14	UTSW	1	181741159	missense	possibly damaging	0.72
R5997:Dnah14	UTSW	1	181770105	missense	probably benign	0.00
R6052:Dnah14	UTSW	1	181666487	missense	possibly damaging	0.50
R6061:Dnah14	UTSW	1	181709051	missense	probably damaging	1.00
R6089:Dnah14	UTSW	1	181750154	missense	probably damaging	1.00
R6092:Dnah14	UTSW	1	181621833	missense	probably benign	0.13
R6145:Dnah14	UTSW	1	181666417	missense	probably benign	0.00
R6163:Dnah14	UTSW	1	181666361	missense	probably benign	0.33
R6246:Dnah14	UTSW	1	181680888	missense	probably benign	0.00
R6302:Dnah14	UTSW	1	181601206	missense	possibly damaging	0.96
R6306:Dnah14	UTSW	1	181585024	frame shift	probably null
R6326:Dnah14	UTSW	1	181783556	missense	probably damaging	1.00
R6348:Dnah14	UTSW	1	181626720	missense	possibly damaging	0.83
R6367:Dnah14	UTSW	1	181755386	splice site	probably null
R6376:Dnah14	UTSW	1	181605894	missense	possibly damaging	0.79
R6389:Dnah14	UTSW	1	181651202	critical splice donor site	probably null
R6433:Dnah14	UTSW	1	181651657	missense	probably damaging	0.99
R6454:Dnah14	UTSW	1	181783705	missense	probably damaging	1.00
R6476:Dnah14	UTSW	1	181744768	missense	probably benign	0.26
R6523:Dnah14	UTSW	1	181643621	missense	probably benign	0.00
R6529:Dnah14	UTSW	1	181666469	missense	probably damaging	0.98
R6538:Dnah14	UTSW	1	181584985	missense	unknown
R6546:Dnah14	UTSW	1	181738987	missense	probably damaging	1.00
R6752:Dnah14	UTSW	1	181593452	missense	probably benign	0.07
R6762:Dnah14	UTSW	1	181757259	missense	probably damaging	1.00
R6786:Dnah14	UTSW	1	181641405	missense	probably benign	0.21
R6849:Dnah14	UTSW	1	181808945	missense	probably benign	0.00
R6877:Dnah14	UTSW	1	181628432	missense	possibly damaging	0.82
R6912:Dnah14	UTSW	1	181750183	missense	possibly damaging	0.83
R6919:Dnah14	UTSW	1	181585066	missense	probably benign	0.04
R6924:Dnah14	UTSW	1	181627952	missense	probably benign	0.04
R6957:Dnah14	UTSW	1	181785175	missense	possibly damaging	0.92
R6980:Dnah14	UTSW	1	181648230	missense	probably benign	0.00
R7018:Dnah14	UTSW	1	181626944	missense	possibly damaging	0.55
R7046:Dnah14	UTSW	1	181623003	missense	probably benign	0.01
R7058:Dnah14	UTSW	1	181698049	missense	probably benign	0.00
R7068:Dnah14	UTSW	1	181769790	missense	probably benign	0.35
R7115:Dnah14	UTSW	1	181720145	missense	probably damaging	1.00
R7130:Dnah14	UTSW	1	181745958	nonsense	probably null
R7165:Dnah14	UTSW	1	181704535	missense	probably benign	0.00
R7169:Dnah14	UTSW	1	181702365	missense	probably benign	0.00
R7184:Dnah14	UTSW	1	181704529	nonsense	probably null
R7232:Dnah14	UTSW	1	181757363	missense	probably damaging	1.00
R7260:Dnah14	UTSW	1	181706744	missense	probably damaging	0.99
R7276:Dnah14	UTSW	1	181685807	missense	probably benign	0.41
R7290:Dnah14	UTSW	1	181628174	missense	probably benign	0.20
R7314:Dnah14	UTSW	1	181785254	splice site	probably null
R7326:Dnah14	UTSW	1	181598403	missense	probably benign	0.02
R7336:Dnah14	UTSW	1	181797734	missense	probably damaging	0.96
R7363:Dnah14	UTSW	1	181690524	splice site	probably null
R7371:Dnah14	UTSW	1	181626885	missense	probably benign	0.05
R7376:Dnah14	UTSW	1	181763402	missense	probably benign	0.03
R7418:Dnah14	UTSW	1	181616742	missense	possibly damaging	0.92
R7473:Dnah14	UTSW	1	181752139	missense	probably damaging	0.99
R7514:Dnah14	UTSW	1	181628067	missense	probably damaging	0.96
R7555:Dnah14	UTSW	1	181770054	missense	probably benign	0.26
R7641:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7663:Dnah14	UTSW	1	181752155	splice site	probably null
R7674:Dnah14	UTSW	1	181707533	missense	probably benign	0.01
R7680:Dnah14	UTSW	1	181685800	missense	probably benign	0.15
R7709:Dnah14	UTSW	1	181702484	critical splice donor site	probably null
R7842:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
R7861:Dnah14	UTSW	1	181616759	missense	probably damaging	1.00
R7988:Dnah14	UTSW	1	181783574	missense	probably damaging	0.97
R8016:Dnah14	UTSW	1	181648311	missense	probably benign	0.05
R8042:Dnah14	UTSW	1	181643631	critical splice donor site	probably null
R8071:Dnah14	UTSW	1	181615894	missense	possibly damaging	0.84
R8086:Dnah14	UTSW	1	181766232	missense	probably damaging	1.00
R8095:Dnah14	UTSW	1	181806032	nonsense	probably null
R8139:Dnah14	UTSW	1	181755288	missense	probably damaging	1.00
R8176:Dnah14	UTSW	1	181657033	missense	probably damaging	0.96
R8193:Dnah14	UTSW	1	181688205	missense	probably damaging	1.00
R8197:Dnah14	UTSW	1	181690101	missense	possibly damaging	0.94
R8209:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8226:Dnah14	UTSW	1	181795545	missense	possibly damaging	0.69
R8251:Dnah14	UTSW	1	181664865	missense	probably damaging	1.00
R8264:Dnah14	UTSW	1	181744792	missense	probably damaging	0.99
R8284:Dnah14	UTSW	1	181773811	missense	probably benign	0.03
R8289:Dnah14	UTSW	1	181716215	nonsense	probably null
R8323:Dnah14	UTSW	1	181704544	missense	probably benign	0.01
R8442:Dnah14	UTSW	1	181741284	missense	probably damaging	0.97
R8507:Dnah14	UTSW	1	181641414	missense	probably benign	0.02
R8509:Dnah14	UTSW	1	181814655	missense
R8520:Dnah14	UTSW	1	181653638	missense	probably damaging	1.00
R8530:Dnah14	UTSW	1	181664946	missense	probably damaging	1.00
R8703:Dnah14	UTSW	1	181666011	nonsense	probably null
R8710:Dnah14	UTSW	1	181690311	missense	probably benign	0.04
R8752:Dnah14	UTSW	1	181628016	missense	probably benign	0.00
R8792:Dnah14	UTSW	1	181814624	missense
R8797:Dnah14	UTSW	1	181637847	missense	probably benign	0.19
R8821:Dnah14	UTSW	1	181792004	nonsense	probably null
R8834:Dnah14	UTSW	1	181616750	missense	possibly damaging	0.83
R8913:Dnah14	UTSW	1	181725498	missense	probably benign	0.01
R8925:Dnah14	UTSW	1	181680756	missense	probably damaging	1.00
R8927:Dnah14	UTSW	1	181680756	missense	probably damaging	1.00
R8934:Dnah14	UTSW	1	181622723	missense	possibly damaging	0.84
R9090:Dnah14	UTSW	1	181769760	missense	probably benign	0.33
R9169:Dnah14	UTSW	1	181605816	missense	probably benign	0.06
R9199:Dnah14	UTSW	1	181651001	missense	possibly damaging	0.50
R9212:Dnah14	UTSW	1	181801287	missense	possibly damaging	0.95
R9213:Dnah14	UTSW	1	181616640	critical splice donor site	probably null
R9271:Dnah14	UTSW	1	181769760	missense	probably benign	0.33
R9282:Dnah14	UTSW	1	181814512	missense
R9350:Dnah14	UTSW	1	181734804	missense	possibly damaging	0.79
R9358:Dnah14	UTSW	1	181709033	missense	probably benign	0.01
R9436:Dnah14	UTSW	1	181680783	missense	probably damaging	1.00
R9484:Dnah14	UTSW	1	181690208	missense	probably benign	0.45
R9484:Dnah14	UTSW	1	181797746	missense	probably benign	0.01
R9486:Dnah14	UTSW	1	181680929	missense	possibly damaging	0.68
R9546:Dnah14	UTSW	1	181593427	critical splice acceptor site	probably null
R9547:Dnah14	UTSW	1	181593427	critical splice acceptor site	probably null
R9578:Dnah14	UTSW	1	181674442	missense	probably benign	0.16
R9654:Dnah14	UTSW	1	181766339	missense	probably benign	0.01
R9681:Dnah14	UTSW	1	181734849	missense	possibly damaging	0.91
R9683:Dnah14	UTSW	1	181598944	missense	probably benign	0.01
R9687:Dnah14	UTSW	1	181598413	missense	probably benign	0.01
R9718:Dnah14	UTSW	1	181622979	missense	probably benign	0.08
R9751:Dnah14	UTSW	1	181792045	missense	probably damaging	1.00
R9757:Dnah14	UTSW	1	181685784	missense	probably benign	0.03
RF007:Dnah14	UTSW	1	181685809	missense	probably benign	0.00
RF012:Dnah14	UTSW	1	181627898	missense	probably damaging	0.99
Z1176:Dnah14	UTSW	1	181757351	missense	possibly damaging	0.83
Z1177:Dnah14	UTSW	1	181690320	missense	probably benign	0.03
Z1177:Dnah14	UTSW	1	181763334	missense	probably damaging	1.00
Z1177:Dnah14	UTSW	1	181766304	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTGAGGCTGAGGTAGACC -3'
(R):5'- GGGTATCTCAAGTTATCCTGGAG -3'

Sequencing Primer
(F):5'- ACCGGGGTGAGTGGTCAG -3'
(R):5'- TCAAGTTATCCTGGAGATAGGGAG -3'

Posted On

2020-10-20