Mutagenetix > Incidental Mutations

Incidental Mutation 'R8458:Gins1'

655099

Institutional Source

Beutler Lab

Gene Symbol

Gins1

Ensembl Gene

ENSMUSG00000027454

Gene Name

GINS complex subunit 1 (Psf1 homolog)

Synonyms

Psf1, 2810418N01Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8458 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

150905400-150931280 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 150930887 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 190 (V190A)

Ref Sequence

ENSEMBL: ENSMUSP00000028948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028948] [ENSMUST00000109896]

Predicted Effect

probably benign
Transcript: ENSMUST00000028948
AA Change: V190A

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000028948
Gene: ENSMUSG00000027454
AA Change: V190A

Domain	Start	End	E-Value	Type
PDB:2Q9Q\|G	1	196	1e-141	PDB
Blast:KISc	112	188	3e-17	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000109896

SMART Domains

Protein: ENSMUSP00000105522
Gene: ENSMUSG00000068115

Domain	Start	End	E-Value	Type
EFh	12	40	6.56e0	SMART
low complexity region	76	93	N/A	INTRINSIC
EFh	201	229	4.45e1	SMART
EFh	238	266	8.98e-4	SMART
low complexity region	295	306	N/A	INTRINSIC
coiled coil region	381	423	N/A	INTRINSIC
coiled coil region	461	517	N/A	INTRINSIC
coiled coil region	541	584	N/A	INTRINSIC
coiled coil region	620	699	N/A	INTRINSIC
coiled coil region	728	751	N/A	INTRINSIC
coiled coil region	835	863	N/A	INTRINSIC
coiled coil region	1058	1334	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The yeast heterotetrameric GINS complex is made up of Sld5 (GINS4; MIM 610611), Psf1, Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele display disorganized embryonic and extraembryonic structures and fail to develop past E5.5; mutant blastocysts fail to exhibit outgrowth in culture and show a cell proliferation defect and inner cell mass apoptosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts20	T	A	15: 94,353,640	H422L	probably benign	Het
Adgra3	G	T	5: 49,987,671	P527T	probably damaging	Het
Afg1l	A	G	10: 42,426,521	V161A	probably damaging	Het
Als2cl	A	C	9: 110,884,957	E65A	probably damaging	Het
Arl3	A	C	19: 46,558,270	S39A	probably benign	Het
Cacna1a	T	C	8: 84,549,458	V560A	probably damaging	Het
Ccr10	C	T	11: 101,174,156	G183R	probably damaging	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Chkb	A	T	15: 89,428,173	V213E	possibly damaging	Het
Chst5	A	G	8: 111,890,790	V66A	probably damaging	Het
Crx	C	A	7: 15,868,106	A216S	possibly damaging	Het
Ctnnd1	T	C	2: 84,613,943	D556G	probably damaging	Het
Cyp4a14	C	A	4: 115,495,932	G61V	probably damaging	Het
Cyp4f17	T	A	17: 32,520,576	F157L	probably damaging	Het
Dnah12	A	T	14: 26,826,892		probably null	Het
Dnah14	A	C	1: 181,806,012	H4P		Het
Dnah7a	T	C	1: 53,617,983	D878G	probably benign	Het
Epb41l1	C	T	2: 156,521,764	T731I	probably benign	Het
Epg5	G	C	18: 77,948,731	E214D	probably benign	Het
Fam171b	A	G	2: 83,860,520	T276A	probably benign	Het
Fat4	G	A	3: 38,981,553	R3118H	probably benign	Het
Fbrs	C	T	7: 127,483,157	R327W	probably damaging	Het
Fmo3	A	G	1: 162,966,940	V187A	possibly damaging	Het
Gm17067	T	C	7: 42,708,731	S116G	probably damaging	Het
Gm5478	A	G	15: 101,645,427	V250A	probably benign	Het
Gpr85	T	C	6: 13,836,849	T19A	probably benign	Het
Hepacam2	T	C	6: 3,483,358	N217S	probably damaging	Het
Igf1r	T	C	7: 68,195,629	Y889H	probably benign	Het
Itpr2	T	G	6: 146,233,966	R1822S	possibly damaging	Het
Kcnk7	C	T	19: 5,704,379		probably benign	Het
Klk1	T	C	7: 44,225,509	S11P	probably damaging	Het
Klra7	C	T	6: 130,224,146	G216R	probably damaging	Het
Krt34	T	C	11: 100,040,075	D167G	probably damaging	Het
Larp1b	A	C	3: 40,976,560	E291D	probably benign	Het
Lats1	T	A	10: 7,710,924	L950*	probably null	Het
Lrrc2	A	C	9: 110,970,150	D255A	probably damaging	Het
Lrrc49	A	T	9: 60,598,173	M605K	probably benign	Het
Mocos	A	G	18: 24,666,257	K183E	probably benign	Het
Mpl	C	A	4: 118,444,016		probably null	Het
Mroh9	T	A	1: 163,055,681	T410S	probably damaging	Het
Notch3	T	C	17: 32,156,050	E430G	probably damaging	Het
Nsun6	T	C	2: 15,030,052	T252A	probably benign	Het
Ntrk1	C	A	3: 87,791,669		probably null	Het
Nts	G	T	10: 102,485,060	T56N	probably damaging	Het
Nup210l	A	G	3: 90,185,567	D1276G	probably null	Het
Olfr1255	G	T	2: 89,817,150	V269F	probably damaging	Het
Olfr1458	T	C	19: 13,102,476	Y276C	probably damaging	Het
Olfr642	C	A	7: 104,049,668	A229S	possibly damaging	Het
Osbpl8	A	G	10: 111,277,316	S535G	possibly damaging	Het
Pax9	A	G	12: 56,696,765	I66V	possibly damaging	Het
Pja2	A	G	17: 64,292,848	V547A	probably damaging	Het
Plekhs1	T	C	19: 56,477,158	L185S	probably benign	Het
Prkdc	T	A	16: 15,790,676		probably null	Het
Ptgdr2	A	T	19: 10,940,421	T101S	possibly damaging	Het
Ptprd	T	C	4: 76,066,259	D550G	probably benign	Het
Ptx3	G	T	3: 66,220,998	R160L	probably benign	Het
Rdh16f1	A	C	10: 127,788,845	E184A	probably damaging	Het
Rfx3	C	T	19: 27,793,672	E560K	possibly damaging	Het
Scgb2b24	T	C	7: 33,737,354	Q111R	probably benign	Het
Spg20	A	G	3: 55,124,894	D383G	probably damaging	Het
Stpg3	C	A	2: 25,213,321	R252L	probably damaging	Het
Tcp11l2	C	T	10: 84,613,532	Q454*	probably null	Het
Trav10d	A	G	14: 52,811,323	Y57C	probably damaging	Het
Vmn1r170	T	A	7: 23,606,896	M241K	possibly damaging	Het
Vwa8	T	A	14: 79,064,892	N1000K	probably damaging	Het
Wdsub1	T	C	2: 59,861,701	E329G	probably benign	Het
Wnk4	C	A	11: 101,275,321	C891*	probably null	Het
Zdhhc16	G	T	19: 41,939,654	C204F	probably damaging	Het
Zfp868	T	C	8: 69,611,908	I259V	possibly damaging	Het
Zranb3	G	T	1: 127,992,910	Q426K	probably damaging	Het

Other mutations in Gins1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1352:Gins1	UTSW	2	150930848	nonsense	probably null
R1575:Gins1	UTSW	2	150912838	missense	probably benign
R4361:Gins1	UTSW	2	150925901	missense	probably damaging	1.00
R4362:Gins1	UTSW	2	150909762	missense	probably damaging	1.00
R4618:Gins1	UTSW	2	150917861	splice site	probably null
R5769:Gins1	UTSW	2	150925998	missense	probably damaging	0.99
R6642:Gins1	UTSW	2	150928118	critical splice donor site	probably null
R6700:Gins1	UTSW	2	150916228	missense	probably damaging	1.00
R7038:Gins1	UTSW	2	150917871	missense	probably damaging	1.00
R7072:Gins1	UTSW	2	150909751	splice site	probably null
R7325:Gins1	UTSW	2	150916166	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGTTAGCTTTTGACTACACCGC -3'
(R):5'- GAGTACAATATTACTGTGGGAATGG -3'

Sequencing Primer
(F):5'- TTTGACTACACCGCTGTACAAG -3'
(R):5'- GGTTTCTCAAATCCTAAGCAGGTGC -3'

Posted On

2020-10-20