Incidental Mutation 'R8458:Gins1'
ID655099
Institutional Source Beutler Lab
Gene Symbol Gins1
Ensembl Gene ENSMUSG00000027454
Gene NameGINS complex subunit 1 (Psf1 homolog)
SynonymsPsf1, 2810418N01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8458 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location150905400-150931280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150930887 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 190 (V190A)
Ref Sequence ENSEMBL: ENSMUSP00000028948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028948] [ENSMUST00000109896]
Predicted Effect probably benign
Transcript: ENSMUST00000028948
AA Change: V190A

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028948
Gene: ENSMUSG00000027454
AA Change: V190A

DomainStartEndE-ValueType
PDB:2Q9Q|G 1 196 1e-141 PDB
Blast:KISc 112 188 3e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109896
SMART Domains Protein: ENSMUSP00000105522
Gene: ENSMUSG00000068115

DomainStartEndE-ValueType
EFh 12 40 6.56e0 SMART
low complexity region 76 93 N/A INTRINSIC
EFh 201 229 4.45e1 SMART
EFh 238 266 8.98e-4 SMART
low complexity region 295 306 N/A INTRINSIC
coiled coil region 381 423 N/A INTRINSIC
coiled coil region 461 517 N/A INTRINSIC
coiled coil region 541 584 N/A INTRINSIC
coiled coil region 620 699 N/A INTRINSIC
coiled coil region 728 751 N/A INTRINSIC
coiled coil region 835 863 N/A INTRINSIC
coiled coil region 1058 1334 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The yeast heterotetrameric GINS complex is made up of Sld5 (GINS4; MIM 610611), Psf1, Psf2 (GINS2; MIM 610609), and Psf3 (GINS3; MIM 610610). The formation of the GINS complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts (Ueno et al., 2005 [PubMed 16287864]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Embryos homozygous for a knock-out allele display disorganized embryonic and extraembryonic structures and fail to develop past E5.5; mutant blastocysts fail to exhibit outgrowth in culture and show a cell proliferation defect and inner cell mass apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T A 15: 94,353,640 H422L probably benign Het
Adgra3 G T 5: 49,987,671 P527T probably damaging Het
Afg1l A G 10: 42,426,521 V161A probably damaging Het
Als2cl A C 9: 110,884,957 E65A probably damaging Het
Arl3 A C 19: 46,558,270 S39A probably benign Het
Cacna1a T C 8: 84,549,458 V560A probably damaging Het
Ccr10 C T 11: 101,174,156 G183R probably damaging Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Chkb A T 15: 89,428,173 V213E possibly damaging Het
Chst5 A G 8: 111,890,790 V66A probably damaging Het
Crx C A 7: 15,868,106 A216S possibly damaging Het
Ctnnd1 T C 2: 84,613,943 D556G probably damaging Het
Cyp4a14 C A 4: 115,495,932 G61V probably damaging Het
Cyp4f17 T A 17: 32,520,576 F157L probably damaging Het
Dnah12 A T 14: 26,826,892 probably null Het
Dnah14 A C 1: 181,806,012 H4P Het
Dnah7a T C 1: 53,617,983 D878G probably benign Het
Epb41l1 C T 2: 156,521,764 T731I probably benign Het
Epg5 G C 18: 77,948,731 E214D probably benign Het
Fam171b A G 2: 83,860,520 T276A probably benign Het
Fat4 G A 3: 38,981,553 R3118H probably benign Het
Fbrs C T 7: 127,483,157 R327W probably damaging Het
Fmo3 A G 1: 162,966,940 V187A possibly damaging Het
Gm17067 T C 7: 42,708,731 S116G probably damaging Het
Gm5478 A G 15: 101,645,427 V250A probably benign Het
Gpr85 T C 6: 13,836,849 T19A probably benign Het
Hepacam2 T C 6: 3,483,358 N217S probably damaging Het
Igf1r T C 7: 68,195,629 Y889H probably benign Het
Itpr2 T G 6: 146,233,966 R1822S possibly damaging Het
Kcnk7 C T 19: 5,704,379 probably benign Het
Klk1 T C 7: 44,225,509 S11P probably damaging Het
Klra7 C T 6: 130,224,146 G216R probably damaging Het
Krt34 T C 11: 100,040,075 D167G probably damaging Het
Larp1b A C 3: 40,976,560 E291D probably benign Het
Lats1 T A 10: 7,710,924 L950* probably null Het
Lrrc2 A C 9: 110,970,150 D255A probably damaging Het
Lrrc49 A T 9: 60,598,173 M605K probably benign Het
Mocos A G 18: 24,666,257 K183E probably benign Het
Mpl C A 4: 118,444,016 probably null Het
Mroh9 T A 1: 163,055,681 T410S probably damaging Het
Notch3 T C 17: 32,156,050 E430G probably damaging Het
Nsun6 T C 2: 15,030,052 T252A probably benign Het
Ntrk1 C A 3: 87,791,669 probably null Het
Nts G T 10: 102,485,060 T56N probably damaging Het
Nup210l A G 3: 90,185,567 D1276G probably null Het
Olfr1255 G T 2: 89,817,150 V269F probably damaging Het
Olfr1458 T C 19: 13,102,476 Y276C probably damaging Het
Olfr642 C A 7: 104,049,668 A229S possibly damaging Het
Osbpl8 A G 10: 111,277,316 S535G possibly damaging Het
Pax9 A G 12: 56,696,765 I66V possibly damaging Het
Pja2 A G 17: 64,292,848 V547A probably damaging Het
Plekhs1 T C 19: 56,477,158 L185S probably benign Het
Prkdc T A 16: 15,790,676 probably null Het
Ptgdr2 A T 19: 10,940,421 T101S possibly damaging Het
Ptprd T C 4: 76,066,259 D550G probably benign Het
Ptx3 G T 3: 66,220,998 R160L probably benign Het
Rdh16f1 A C 10: 127,788,845 E184A probably damaging Het
Rfx3 C T 19: 27,793,672 E560K possibly damaging Het
Scgb2b24 T C 7: 33,737,354 Q111R probably benign Het
Spg20 A G 3: 55,124,894 D383G probably damaging Het
Stpg3 C A 2: 25,213,321 R252L probably damaging Het
Tcp11l2 C T 10: 84,613,532 Q454* probably null Het
Trav10d A G 14: 52,811,323 Y57C probably damaging Het
Vmn1r170 T A 7: 23,606,896 M241K possibly damaging Het
Vwa8 T A 14: 79,064,892 N1000K probably damaging Het
Wdsub1 T C 2: 59,861,701 E329G probably benign Het
Wnk4 C A 11: 101,275,321 C891* probably null Het
Zdhhc16 G T 19: 41,939,654 C204F probably damaging Het
Zfp868 T C 8: 69,611,908 I259V possibly damaging Het
Zranb3 G T 1: 127,992,910 Q426K probably damaging Het
Other mutations in Gins1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1352:Gins1 UTSW 2 150930848 nonsense probably null
R1575:Gins1 UTSW 2 150912838 missense probably benign
R4361:Gins1 UTSW 2 150925901 missense probably damaging 1.00
R4362:Gins1 UTSW 2 150909762 missense probably damaging 1.00
R4618:Gins1 UTSW 2 150917861 splice site probably null
R5769:Gins1 UTSW 2 150925998 missense probably damaging 0.99
R6642:Gins1 UTSW 2 150928118 critical splice donor site probably null
R6700:Gins1 UTSW 2 150916228 missense probably damaging 1.00
R7038:Gins1 UTSW 2 150917871 missense probably damaging 1.00
R7072:Gins1 UTSW 2 150909751 splice site probably null
R7325:Gins1 UTSW 2 150916166 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTTAGCTTTTGACTACACCGC -3'
(R):5'- GAGTACAATATTACTGTGGGAATGG -3'

Sequencing Primer
(F):5'- TTTGACTACACCGCTGTACAAG -3'
(R):5'- GGTTTCTCAAATCCTAAGCAGGTGC -3'
Posted On2020-10-20