Incidental Mutation 'R8458:Nup210l'
ID 655106
Institutional Source Beutler Lab
Gene Symbol Nup210l
Ensembl Gene ENSMUSG00000027939
Gene Name nucleoporin 210-like
Synonyms 4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock # R8458 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 90104132-90212048 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90185567 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1276 (D1276G)
Ref Sequence ENSEMBL: ENSMUSP00000029548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]
AlphaFold Q9D2F7
Predicted Effect probably null
Transcript: ENSMUST00000029548
AA Change: D1276G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: D1276G

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BID_2 457 536 2.05e1 SMART
Blast:S1 949 1023 2e-16 BLAST
BID_2 1077 1152 4.51e-11 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200410
AA Change: D1276G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: D1276G

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
BID_2 457 536 6.9e-2 SMART
Blast:S1 938 1023 9e-17 BLAST
BID_2 1077 1152 1.5e-13 SMART
Blast:BID_2 1468 1550 7e-15 BLAST
transmembrane domain 1807 1829 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T A 15: 94,353,640 H422L probably benign Het
Adgra3 G T 5: 49,987,671 P527T probably damaging Het
Afg1l A G 10: 42,426,521 V161A probably damaging Het
Als2cl A C 9: 110,884,957 E65A probably damaging Het
Arl3 A C 19: 46,558,270 S39A probably benign Het
Cacna1a T C 8: 84,549,458 V560A probably damaging Het
Ccr10 C T 11: 101,174,156 G183R probably damaging Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Chkb A T 15: 89,428,173 V213E possibly damaging Het
Chst5 A G 8: 111,890,790 V66A probably damaging Het
Crx C A 7: 15,868,106 A216S possibly damaging Het
Ctnnd1 T C 2: 84,613,943 D556G probably damaging Het
Cyp4a14 C A 4: 115,495,932 G61V probably damaging Het
Cyp4f17 T A 17: 32,520,576 F157L probably damaging Het
Dnah12 A T 14: 26,826,892 probably null Het
Dnah14 A C 1: 181,806,012 H4P Het
Dnah7a T C 1: 53,617,983 D878G probably benign Het
Epb41l1 C T 2: 156,521,764 T731I probably benign Het
Epg5 G C 18: 77,948,731 E214D probably benign Het
Fam171b A G 2: 83,860,520 T276A probably benign Het
Fat4 G A 3: 38,981,553 R3118H probably benign Het
Fbrs C T 7: 127,483,157 R327W probably damaging Het
Fmo3 A G 1: 162,966,940 V187A possibly damaging Het
Gins1 T C 2: 150,930,887 V190A probably benign Het
Gm17067 T C 7: 42,708,731 S116G probably damaging Het
Gm5478 A G 15: 101,645,427 V250A probably benign Het
Gpr85 T C 6: 13,836,849 T19A probably benign Het
Hepacam2 T C 6: 3,483,358 N217S probably damaging Het
Igf1r T C 7: 68,195,629 Y889H probably benign Het
Itpr2 T G 6: 146,233,966 R1822S possibly damaging Het
Kcnk7 C T 19: 5,704,379 probably benign Het
Klk1 T C 7: 44,225,509 S11P probably damaging Het
Klra7 C T 6: 130,224,146 G216R probably damaging Het
Krt34 T C 11: 100,040,075 D167G probably damaging Het
Larp1b A C 3: 40,976,560 E291D probably benign Het
Lats1 T A 10: 7,710,924 L950* probably null Het
Lrrc2 A C 9: 110,970,150 D255A probably damaging Het
Lrrc49 A T 9: 60,598,173 M605K probably benign Het
Mocos A G 18: 24,666,257 K183E probably benign Het
Mpl C A 4: 118,444,016 probably null Het
Mroh9 T A 1: 163,055,681 T410S probably damaging Het
Notch3 T C 17: 32,156,050 E430G probably damaging Het
Nsun6 T C 2: 15,030,052 T252A probably benign Het
Ntrk1 C A 3: 87,791,669 probably null Het
Nts G T 10: 102,485,060 T56N probably damaging Het
Olfr1255 G T 2: 89,817,150 V269F probably damaging Het
Olfr1458 T C 19: 13,102,476 Y276C probably damaging Het
Olfr642 C A 7: 104,049,668 A229S possibly damaging Het
Osbpl8 A G 10: 111,277,316 S535G possibly damaging Het
Pax9 A G 12: 56,696,765 I66V possibly damaging Het
Pja2 A G 17: 64,292,848 V547A probably damaging Het
Plekhs1 T C 19: 56,477,158 L185S probably benign Het
Prkdc T A 16: 15,790,676 probably null Het
Ptgdr2 A T 19: 10,940,421 T101S possibly damaging Het
Ptprd T C 4: 76,066,259 D550G probably benign Het
Ptx3 G T 3: 66,220,998 R160L probably benign Het
Rdh16f1 A C 10: 127,788,845 E184A probably damaging Het
Rfx3 C T 19: 27,793,672 E560K possibly damaging Het
Scgb2b24 T C 7: 33,737,354 Q111R probably benign Het
Spg20 A G 3: 55,124,894 D383G probably damaging Het
Stpg3 C A 2: 25,213,321 R252L probably damaging Het
Tcp11l2 C T 10: 84,613,532 Q454* probably null Het
Trav10d A G 14: 52,811,323 Y57C probably damaging Het
Vmn1r170 T A 7: 23,606,896 M241K possibly damaging Het
Vwa8 T A 14: 79,064,892 N1000K probably damaging Het
Wdsub1 T C 2: 59,861,701 E329G probably benign Het
Wnk4 C A 11: 101,275,321 C891* probably null Het
Zdhhc16 G T 19: 41,939,654 C204F probably damaging Het
Zfp868 T C 8: 69,611,908 I259V possibly damaging Het
Zranb3 G T 1: 127,992,910 Q426K probably damaging Het
Other mutations in Nup210l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Nup210l APN 3 90190849 splice site probably benign
IGL00813:Nup210l APN 3 90132418 missense probably benign 0.00
IGL01375:Nup210l APN 3 90159893 missense probably damaging 0.96
IGL01731:Nup210l APN 3 90154566 missense probably damaging 1.00
IGL01786:Nup210l APN 3 90122776 nonsense probably null
IGL01958:Nup210l APN 3 90203924 missense possibly damaging 0.74
IGL02094:Nup210l APN 3 90180213 critical splice donor site probably null
IGL02120:Nup210l APN 3 90136862 missense probably damaging 1.00
IGL02313:Nup210l APN 3 90122792 missense probably damaging 1.00
IGL02336:Nup210l APN 3 90181552 critical splice donor site probably null
IGL02348:Nup210l APN 3 90104164 utr 5 prime probably benign
IGL02372:Nup210l APN 3 90201971 missense possibly damaging 0.80
IGL02557:Nup210l APN 3 90124230 missense probably damaging 1.00
IGL02559:Nup210l APN 3 90159953 missense probably benign 0.02
IGL02738:Nup210l APN 3 90136850 missense possibly damaging 0.80
IGL03231:Nup210l APN 3 90189545 missense probably damaging 1.00
IGL03257:Nup210l APN 3 90180148 critical splice acceptor site probably null
IGL03388:Nup210l APN 3 90170044 missense probably damaging 1.00
IGL03134:Nup210l UTSW 3 90190887 missense possibly damaging 0.85
R0003:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R0040:Nup210l UTSW 3 90181905 missense probably damaging 1.00
R0083:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0090:Nup210l UTSW 3 90211779 missense probably benign 0.00
R0108:Nup210l UTSW 3 90189575 missense probably damaging 1.00
R0142:Nup210l UTSW 3 90172113 missense probably damaging 1.00
R0306:Nup210l UTSW 3 90207368 missense probably benign 0.13
R0332:Nup210l UTSW 3 90132309 splice site probably benign
R0346:Nup210l UTSW 3 90189438 missense probably damaging 1.00
R0463:Nup210l UTSW 3 90180211 missense probably null 1.00
R0622:Nup210l UTSW 3 90167740 missense probably damaging 0.98
R0765:Nup210l UTSW 3 90119877 missense probably damaging 0.99
R0990:Nup210l UTSW 3 90211925 missense probably benign 0.00
R1014:Nup210l UTSW 3 90170048 missense possibly damaging 0.62
R1036:Nup210l UTSW 3 90192940 splice site probably benign
R1177:Nup210l UTSW 3 90202003 missense probably benign 0.11
R1183:Nup210l UTSW 3 90159945 missense probably benign 0.04
R1188:Nup210l UTSW 3 90198179 missense probably benign 0.16
R1457:Nup210l UTSW 3 90190972 missense possibly damaging 0.68
R1471:Nup210l UTSW 3 90170562 missense probably benign
R1627:Nup210l UTSW 3 90144169 missense probably benign 0.15
R1778:Nup210l UTSW 3 90189486 missense probably damaging 0.99
R1827:Nup210l UTSW 3 90154557 missense probably damaging 1.00
R1843:Nup210l UTSW 3 90172086 missense probably damaging 0.96
R1858:Nup210l UTSW 3 90154499 missense probably damaging 0.97
R1942:Nup210l UTSW 3 90151237 missense probably benign 0.01
R2015:Nup210l UTSW 3 90185432 missense probably damaging 1.00
R2113:Nup210l UTSW 3 90190974 missense possibly damaging 0.48
R2944:Nup210l UTSW 3 90181545 missense probably damaging 1.00
R3736:Nup210l UTSW 3 90120013 missense probably damaging 1.00
R3740:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3741:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3742:Nup210l UTSW 3 90207394 missense probably benign 0.08
R3771:Nup210l UTSW 3 90119894 nonsense probably null
R3773:Nup210l UTSW 3 90119894 nonsense probably null
R3879:Nup210l UTSW 3 90185473 missense probably damaging 1.00
R3882:Nup210l UTSW 3 90124210 missense probably benign 0.19
R3953:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3954:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3955:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R3956:Nup210l UTSW 3 90193054 missense possibly damaging 0.89
R4200:Nup210l UTSW 3 90119911 missense probably damaging 1.00
R4290:Nup210l UTSW 3 90207326 missense probably benign 0.00
R4328:Nup210l UTSW 3 90175835 splice site probably null
R4629:Nup210l UTSW 3 90167875 missense probably benign 0.21
R4629:Nup210l UTSW 3 90190874 nonsense probably null
R4897:Nup210l UTSW 3 90193071 missense probably damaging 1.00
R4906:Nup210l UTSW 3 90170030 missense probably benign 0.06
R4966:Nup210l UTSW 3 90106901 missense probably benign 0.00
R5004:Nup210l UTSW 3 90180165 nonsense probably null
R5237:Nup210l UTSW 3 90180198 missense probably benign 0.00
R5499:Nup210l UTSW 3 90174370 missense probably damaging 1.00
R5522:Nup210l UTSW 3 90154665 missense probably benign 0.10
R5627:Nup210l UTSW 3 90144250 missense probably damaging 0.97
R5678:Nup210l UTSW 3 90190959 missense probably damaging 0.99
R5726:Nup210l UTSW 3 90129207 splice site probably null
R5792:Nup210l UTSW 3 90199857 missense probably damaging 1.00
R6129:Nup210l UTSW 3 90104176 missense probably benign 0.00
R6272:Nup210l UTSW 3 90170024 missense possibly damaging 0.57
R6290:Nup210l UTSW 3 90119909 nonsense probably null
R6293:Nup210l UTSW 3 90115064 missense probably damaging 1.00
R6446:Nup210l UTSW 3 90172068 missense probably damaging 1.00
R6698:Nup210l UTSW 3 90182508 missense possibly damaging 0.57
R6855:Nup210l UTSW 3 90136924 missense probably benign 0.01
R6895:Nup210l UTSW 3 90159924 missense probably damaging 0.97
R6899:Nup210l UTSW 3 90167897 missense possibly damaging 0.77
R6978:Nup210l UTSW 3 90154566 missense possibly damaging 0.86
R6980:Nup210l UTSW 3 90119927 missense probably benign 0.04
R7038:Nup210l UTSW 3 90159947 missense probably damaging 1.00
R7273:Nup210l UTSW 3 90118547 missense probably benign 0.04
R7450:Nup210l UTSW 3 90115188 critical splice donor site probably null
R7514:Nup210l UTSW 3 90210459 critical splice donor site probably null
R7658:Nup210l UTSW 3 90211993 missense probably benign 0.43
R7735:Nup210l UTSW 3 90185576 missense probably damaging 1.00
R7772:Nup210l UTSW 3 90159926 missense probably damaging 1.00
R7800:Nup210l UTSW 3 90134597 missense probably damaging 1.00
R7840:Nup210l UTSW 3 90122729 missense probably benign 0.08
R7847:Nup210l UTSW 3 90151123 missense probably benign
R7848:Nup210l UTSW 3 90203905 missense probably benign 0.01
R8084:Nup210l UTSW 3 90136058 missense probably benign 0.15
R8121:Nup210l UTSW 3 90115121 missense probably damaging 1.00
R8421:Nup210l UTSW 3 90203867 missense probably damaging 1.00
R8701:Nup210l UTSW 3 90122814 missense probably benign 0.41
R8720:Nup210l UTSW 3 90210374 missense probably benign 0.00
R8770:Nup210l UTSW 3 90118543 missense probably damaging 1.00
R8896:Nup210l UTSW 3 90118625 missense probably damaging 1.00
R9033:Nup210l UTSW 3 90198089 missense probably benign
R9371:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9373:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9381:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9426:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9427:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9501:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9523:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9574:Nup210l UTSW 3 90210386 missense probably benign
R9612:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9654:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9660:Nup210l UTSW 3 90198095 missense probably benign 0.30
R9660:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9662:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9682:Nup210l UTSW 3 90144162 missense possibly damaging 0.79
R9729:Nup210l UTSW 3 90199866 missense probably benign 0.01
R9750:Nup210l UTSW 3 90210352 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CCTGTGTGAGAAGCAAGCAC -3'
(R):5'- TAGGGTTACAGATGCGCACC -3'

Sequencing Primer
(F):5'- CCCAGGGATGCTTTCTCAG -3'
(R):5'- TTTAAGGGATCAAGCTCAGGC -3'
Posted On 2020-10-20