Incidental Mutation 'R8458:Cyp4a14'
ID 655109
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission 067835-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R8458 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 115353129 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 61 (G61V)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably damaging
Transcript: ENSMUST00000030487
AA Change: G61V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: G61V

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T A 15: 94,251,521 (GRCm39) H422L probably benign Het
Adgra3 G T 5: 50,145,013 (GRCm39) P527T probably damaging Het
Afg1l A G 10: 42,302,517 (GRCm39) V161A probably damaging Het
Als2cl A C 9: 110,714,025 (GRCm39) E65A probably damaging Het
Arl3 A C 19: 46,546,709 (GRCm39) S39A probably benign Het
Cacna1a T C 8: 85,276,087 (GRCm39) V560A probably damaging Het
Ccr10 C T 11: 101,064,982 (GRCm39) G183R probably damaging Het
Celsr2 T A 3: 108,306,218 (GRCm39) T2029S probably benign Het
Chkb A T 15: 89,312,376 (GRCm39) V213E possibly damaging Het
Chst5 A G 8: 112,617,422 (GRCm39) V66A probably damaging Het
Crx C A 7: 15,602,031 (GRCm39) A216S possibly damaging Het
Ctnnd1 T C 2: 84,444,287 (GRCm39) D556G probably damaging Het
Cyp4f17 T A 17: 32,739,550 (GRCm39) F157L probably damaging Het
Dnah12 A T 14: 26,548,849 (GRCm39) probably null Het
Dnah14 A C 1: 181,633,577 (GRCm39) H4P Het
Dnah7a T C 1: 53,657,142 (GRCm39) D878G probably benign Het
Epb41l1 C T 2: 156,363,684 (GRCm39) T731I probably benign Het
Epg5 G C 18: 77,991,946 (GRCm39) E214D probably benign Het
Fam171b A G 2: 83,690,864 (GRCm39) T276A probably benign Het
Fat4 G A 3: 39,035,702 (GRCm39) R3118H probably benign Het
Fbrs C T 7: 127,082,329 (GRCm39) R327W probably damaging Het
Fmo3 A G 1: 162,794,509 (GRCm39) V187A possibly damaging Het
Gins1 T C 2: 150,772,807 (GRCm39) V190A probably benign Het
Gm17067 T C 7: 42,358,155 (GRCm39) S116G probably damaging Het
Gm5478 A G 15: 101,553,862 (GRCm39) V250A probably benign Het
Gpr85 T C 6: 13,836,848 (GRCm39) T19A probably benign Het
Hepacam2 T C 6: 3,483,358 (GRCm39) N217S probably damaging Het
Igf1r T C 7: 67,845,377 (GRCm39) Y889H probably benign Het
Itpr2 T G 6: 146,135,464 (GRCm39) R1822S possibly damaging Het
Kcnk7 C T 19: 5,754,407 (GRCm39) probably benign Het
Klk1 T C 7: 43,874,933 (GRCm39) S11P probably damaging Het
Klra7 C T 6: 130,201,109 (GRCm39) G216R probably damaging Het
Krt34 T C 11: 99,930,901 (GRCm39) D167G probably damaging Het
Larp1b A C 3: 40,930,995 (GRCm39) E291D probably benign Het
Lats1 T A 10: 7,586,688 (GRCm39) L950* probably null Het
Lrrc2 A C 9: 110,799,218 (GRCm39) D255A probably damaging Het
Lrrc49 A T 9: 60,505,456 (GRCm39) M605K probably benign Het
Mocos A G 18: 24,799,314 (GRCm39) K183E probably benign Het
Mpl C A 4: 118,301,213 (GRCm39) probably null Het
Mroh9 T A 1: 162,883,250 (GRCm39) T410S probably damaging Het
Notch3 T C 17: 32,375,024 (GRCm39) E430G probably damaging Het
Nsun6 T C 2: 15,034,863 (GRCm39) T252A probably benign Het
Ntrk1 C A 3: 87,698,976 (GRCm39) probably null Het
Nts G T 10: 102,320,921 (GRCm39) T56N probably damaging Het
Nup210l A G 3: 90,092,874 (GRCm39) D1276G probably null Het
Or4c12b G T 2: 89,647,494 (GRCm39) V269F probably damaging Het
Or51a10 C A 7: 103,698,875 (GRCm39) A229S possibly damaging Het
Or5b105 T C 19: 13,079,840 (GRCm39) Y276C probably damaging Het
Osbpl8 A G 10: 111,113,177 (GRCm39) S535G possibly damaging Het
Pax9 A G 12: 56,743,550 (GRCm39) I66V possibly damaging Het
Pja2 A G 17: 64,599,843 (GRCm39) V547A probably damaging Het
Plekhs1 T C 19: 56,465,590 (GRCm39) L185S probably benign Het
Prkdc T A 16: 15,608,540 (GRCm39) probably null Het
Ptgdr2 A T 19: 10,917,785 (GRCm39) T101S possibly damaging Het
Ptprd T C 4: 75,984,496 (GRCm39) D550G probably benign Het
Ptx3 G T 3: 66,128,419 (GRCm39) R160L probably benign Het
Rdh16f1 A C 10: 127,624,714 (GRCm39) E184A probably damaging Het
Rfx3 C T 19: 27,771,072 (GRCm39) E560K possibly damaging Het
Scgb2b24 T C 7: 33,436,779 (GRCm39) Q111R probably benign Het
Spart A G 3: 55,032,315 (GRCm39) D383G probably damaging Het
Stpg3 C A 2: 25,103,333 (GRCm39) R252L probably damaging Het
Tcp11l2 C T 10: 84,449,396 (GRCm39) Q454* probably null Het
Trav10d A G 14: 53,048,780 (GRCm39) Y57C probably damaging Het
Vmn1r170 T A 7: 23,306,321 (GRCm39) M241K possibly damaging Het
Vwa8 T A 14: 79,302,332 (GRCm39) N1000K probably damaging Het
Wdsub1 T C 2: 59,692,045 (GRCm39) E329G probably benign Het
Wnk4 C A 11: 101,166,147 (GRCm39) C891* probably null Het
Zdhhc16 G T 19: 41,928,093 (GRCm39) C204F probably damaging Het
Zfp868 T C 8: 70,064,559 (GRCm39) I259V possibly damaging Het
Zranb3 G T 1: 127,920,647 (GRCm39) Q426K probably damaging Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATGCTCCACATGACTAAGGC -3'
(R):5'- CGGGTTTCTAAACATTTAGTGACAC -3'

Sequencing Primer
(F):5'- TGACTAAGGCAAACCCACTCTTAG -3'
(R):5'- GTGATCCAGAAACTACTAACCATGGG -3'
Posted On 2020-10-20