Incidental Mutation 'R8458:Scgb2b24'
ID655118
Institutional Source Beutler Lab
Gene Symbol Scgb2b24
Ensembl Gene ENSMUSG00000046438
Gene Namesecretoglobin, family 2B, member 24
SynonymsC2b, Abpbg24, Abpz, Scgb2b3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R8458 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location33737190-33739312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33737354 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 111 (Q111R)
Ref Sequence ENSEMBL: ENSMUSP00000052456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055444]
Predicted Effect probably benign
Transcript: ENSMUST00000055444
AA Change: Q111R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000052456
Gene: ENSMUSG00000046438
AA Change: Q111R

DomainStartEndE-ValueType
low complexity region 5 11 N/A INTRINSIC
Pfam:Feld-I_B 24 90 5.9e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T A 15: 94,353,640 H422L probably benign Het
Adgra3 G T 5: 49,987,671 P527T probably damaging Het
Afg1l A G 10: 42,426,521 V161A probably damaging Het
Als2cl A C 9: 110,884,957 E65A probably damaging Het
Arl3 A C 19: 46,558,270 S39A probably benign Het
Cacna1a T C 8: 84,549,458 V560A probably damaging Het
Ccr10 C T 11: 101,174,156 G183R probably damaging Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Chkb A T 15: 89,428,173 V213E possibly damaging Het
Chst5 A G 8: 111,890,790 V66A probably damaging Het
Crx C A 7: 15,868,106 A216S possibly damaging Het
Ctnnd1 T C 2: 84,613,943 D556G probably damaging Het
Cyp4a14 C A 4: 115,495,932 G61V probably damaging Het
Cyp4f17 T A 17: 32,520,576 F157L probably damaging Het
Dnah12 A T 14: 26,826,892 probably null Het
Dnah14 A C 1: 181,806,012 H4P Het
Dnah7a T C 1: 53,617,983 D878G probably benign Het
Epb41l1 C T 2: 156,521,764 T731I probably benign Het
Epg5 G C 18: 77,948,731 E214D probably benign Het
Fam171b A G 2: 83,860,520 T276A probably benign Het
Fat4 G A 3: 38,981,553 R3118H probably benign Het
Fbrs C T 7: 127,483,157 R327W probably damaging Het
Fmo3 A G 1: 162,966,940 V187A possibly damaging Het
Gins1 T C 2: 150,930,887 V190A probably benign Het
Gm17067 T C 7: 42,708,731 S116G probably damaging Het
Gm5478 A G 15: 101,645,427 V250A probably benign Het
Gpr85 T C 6: 13,836,849 T19A probably benign Het
Hepacam2 T C 6: 3,483,358 N217S probably damaging Het
Igf1r T C 7: 68,195,629 Y889H probably benign Het
Itpr2 T G 6: 146,233,966 R1822S possibly damaging Het
Kcnk7 C T 19: 5,704,379 probably benign Het
Klk1 T C 7: 44,225,509 S11P probably damaging Het
Klra7 C T 6: 130,224,146 G216R probably damaging Het
Krt34 T C 11: 100,040,075 D167G probably damaging Het
Larp1b A C 3: 40,976,560 E291D probably benign Het
Lats1 T A 10: 7,710,924 L950* probably null Het
Lrrc2 A C 9: 110,970,150 D255A probably damaging Het
Lrrc49 A T 9: 60,598,173 M605K probably benign Het
Mocos A G 18: 24,666,257 K183E probably benign Het
Mpl C A 4: 118,444,016 probably null Het
Mroh9 T A 1: 163,055,681 T410S probably damaging Het
Notch3 T C 17: 32,156,050 E430G probably damaging Het
Nsun6 T C 2: 15,030,052 T252A probably benign Het
Ntrk1 C A 3: 87,791,669 probably null Het
Nts G T 10: 102,485,060 T56N probably damaging Het
Nup210l A G 3: 90,185,567 D1276G probably null Het
Olfr1255 G T 2: 89,817,150 V269F probably damaging Het
Olfr1458 T C 19: 13,102,476 Y276C probably damaging Het
Olfr642 C A 7: 104,049,668 A229S possibly damaging Het
Osbpl8 A G 10: 111,277,316 S535G possibly damaging Het
Pax9 A G 12: 56,696,765 I66V possibly damaging Het
Pja2 A G 17: 64,292,848 V547A probably damaging Het
Plekhs1 T C 19: 56,477,158 L185S probably benign Het
Prkdc T A 16: 15,790,676 probably null Het
Ptgdr2 A T 19: 10,940,421 T101S possibly damaging Het
Ptprd T C 4: 76,066,259 D550G probably benign Het
Ptx3 G T 3: 66,220,998 R160L probably benign Het
Rdh16f1 A C 10: 127,788,845 E184A probably damaging Het
Rfx3 C T 19: 27,793,672 E560K possibly damaging Het
Spg20 A G 3: 55,124,894 D383G probably damaging Het
Stpg3 C A 2: 25,213,321 R252L probably damaging Het
Tcp11l2 C T 10: 84,613,532 Q454* probably null Het
Trav10d A G 14: 52,811,323 Y57C probably damaging Het
Vmn1r170 T A 7: 23,606,896 M241K possibly damaging Het
Vwa8 T A 14: 79,064,892 N1000K probably damaging Het
Wdsub1 T C 2: 59,861,701 E329G probably benign Het
Wnk4 C A 11: 101,275,321 C891* probably null Het
Zdhhc16 G T 19: 41,939,654 C204F probably damaging Het
Zfp868 T C 8: 69,611,908 I259V possibly damaging Het
Zranb3 G T 1: 127,992,910 Q426K probably damaging Het
Other mutations in Scgb2b24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01825:Scgb2b24 APN 7 33739227 missense probably damaging 0.97
IGL02328:Scgb2b24 APN 7 33738625 splice site probably benign
PIT4618001:Scgb2b24 UTSW 7 33738611 missense probably damaging 0.96
R3441:Scgb2b24 UTSW 7 33738600 missense probably damaging 1.00
R5874:Scgb2b24 UTSW 7 33737405 missense probably damaging 0.99
R6572:Scgb2b24 UTSW 7 33738477 missense probably damaging 1.00
R6800:Scgb2b24 UTSW 7 33738469 missense probably benign 0.01
R7431:Scgb2b24 UTSW 7 33739249 missense probably benign 0.13
R8096:Scgb2b24 UTSW 7 33739221 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGATCCTCTGAAGACCTTGTTC -3'
(R):5'- TTTCCTGTGGACAAGGAGCAG -3'

Sequencing Primer
(F):5'- CCTCTGAAGACCTTGTTCATAGAGAC -3'
(R):5'- GGACAAGGAGCAGTCTTTTTC -3'
Posted On2020-10-20