Mutagenetix > Incidental Mutation

Incidental Mutation 'R8458:Igf1r'

655121

Institutional Source

Beutler Lab

Gene Symbol

Igf1r

Ensembl Gene

ENSMUSG00000005533

Gene Name

insulin-like growth factor I receptor

Synonyms

line 186, A330103N21Rik, CD221, hyft, IGF-1R

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8458 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

67952827-68233668 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 68195629 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 889 (Y889H)

Ref Sequence

ENSEMBL: ENSMUSP00000005671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005671]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000005671
AA Change: Y889H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: Y889H

Domain	Start	End	E-Value	Type
Pfam:Recep_L_domain	51	161	1.6e-29	PFAM
FU	227	270	2.98e-12	SMART
Pfam:Recep_L_domain	353	467	3.8e-32	PFAM
FN3	490	593	4.67e-2	SMART
FN3	612	815	1.95e-4	SMART
FN3	833	915	7.4e-5	SMART
low complexity region	937	954	N/A	INTRINSIC
TyrKc	1000	1268	8.51e-141	SMART
low complexity region	1285	1303	N/A	INTRINSIC
low complexity region	1306	1319	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts20	T	A	15: 94,353,640	H422L	probably benign	Het
Adgra3	G	T	5: 49,987,671	P527T	probably damaging	Het
Afg1l	A	G	10: 42,426,521	V161A	probably damaging	Het
Als2cl	A	C	9: 110,884,957	E65A	probably damaging	Het
Arl3	A	C	19: 46,558,270	S39A	probably benign	Het
Cacna1a	T	C	8: 84,549,458	V560A	probably damaging	Het
Ccr10	C	T	11: 101,174,156	G183R	probably damaging	Het
Celsr2	T	A	3: 108,398,902	T2029S	probably benign	Het
Chkb	A	T	15: 89,428,173	V213E	possibly damaging	Het
Chst5	A	G	8: 111,890,790	V66A	probably damaging	Het
Crx	C	A	7: 15,868,106	A216S	possibly damaging	Het
Ctnnd1	T	C	2: 84,613,943	D556G	probably damaging	Het
Cyp4a14	C	A	4: 115,495,932	G61V	probably damaging	Het
Cyp4f17	T	A	17: 32,520,576	F157L	probably damaging	Het
Dnah12	A	T	14: 26,826,892		probably null	Het
Dnah14	A	C	1: 181,806,012	H4P		Het
Dnah7a	T	C	1: 53,617,983	D878G	probably benign	Het
Epb41l1	C	T	2: 156,521,764	T731I	probably benign	Het
Epg5	G	C	18: 77,948,731	E214D	probably benign	Het
Fam171b	A	G	2: 83,860,520	T276A	probably benign	Het
Fat4	G	A	3: 38,981,553	R3118H	probably benign	Het
Fbrs	C	T	7: 127,483,157	R327W	probably damaging	Het
Fmo3	A	G	1: 162,966,940	V187A	possibly damaging	Het
Gins1	T	C	2: 150,930,887	V190A	probably benign	Het
Gm17067	T	C	7: 42,708,731	S116G	probably damaging	Het
Gm5478	A	G	15: 101,645,427	V250A	probably benign	Het
Gpr85	T	C	6: 13,836,849	T19A	probably benign	Het
Hepacam2	T	C	6: 3,483,358	N217S	probably damaging	Het
Itpr2	T	G	6: 146,233,966	R1822S	possibly damaging	Het
Kcnk7	C	T	19: 5,704,379		probably benign	Het
Klk1	T	C	7: 44,225,509	S11P	probably damaging	Het
Klra7	C	T	6: 130,224,146	G216R	probably damaging	Het
Krt34	T	C	11: 100,040,075	D167G	probably damaging	Het
Larp1b	A	C	3: 40,976,560	E291D	probably benign	Het
Lats1	T	A	10: 7,710,924	L950*	probably null	Het
Lrrc2	A	C	9: 110,970,150	D255A	probably damaging	Het
Lrrc49	A	T	9: 60,598,173	M605K	probably benign	Het
Mocos	A	G	18: 24,666,257	K183E	probably benign	Het
Mpl	C	A	4: 118,444,016		probably null	Het
Mroh9	T	A	1: 163,055,681	T410S	probably damaging	Het
Notch3	T	C	17: 32,156,050	E430G	probably damaging	Het
Nsun6	T	C	2: 15,030,052	T252A	probably benign	Het
Ntrk1	C	A	3: 87,791,669		probably null	Het
Nts	G	T	10: 102,485,060	T56N	probably damaging	Het
Nup210l	A	G	3: 90,185,567	D1276G	probably null	Het
Olfr1255	G	T	2: 89,817,150	V269F	probably damaging	Het
Olfr1458	T	C	19: 13,102,476	Y276C	probably damaging	Het
Olfr642	C	A	7: 104,049,668	A229S	possibly damaging	Het
Osbpl8	A	G	10: 111,277,316	S535G	possibly damaging	Het
Pax9	A	G	12: 56,696,765	I66V	possibly damaging	Het
Pja2	A	G	17: 64,292,848	V547A	probably damaging	Het
Plekhs1	T	C	19: 56,477,158	L185S	probably benign	Het
Prkdc	T	A	16: 15,790,676		probably null	Het
Ptgdr2	A	T	19: 10,940,421	T101S	possibly damaging	Het
Ptprd	T	C	4: 76,066,259	D550G	probably benign	Het
Ptx3	G	T	3: 66,220,998	R160L	probably benign	Het
Rdh16f1	A	C	10: 127,788,845	E184A	probably damaging	Het
Rfx3	C	T	19: 27,793,672	E560K	possibly damaging	Het
Scgb2b24	T	C	7: 33,737,354	Q111R	probably benign	Het
Spg20	A	G	3: 55,124,894	D383G	probably damaging	Het
Stpg3	C	A	2: 25,213,321	R252L	probably damaging	Het
Tcp11l2	C	T	10: 84,613,532	Q454*	probably null	Het
Trav10d	A	G	14: 52,811,323	Y57C	probably damaging	Het
Vmn1r170	T	A	7: 23,606,896	M241K	possibly damaging	Het
Vwa8	T	A	14: 79,064,892	N1000K	probably damaging	Het
Wdsub1	T	C	2: 59,861,701	E329G	probably benign	Het
Wnk4	C	A	11: 101,275,321	C891*	probably null	Het
Zdhhc16	G	T	19: 41,939,654	C204F	probably damaging	Het
Zfp868	T	C	8: 69,611,908	I259V	possibly damaging	Het
Zranb3	G	T	1: 127,992,910	Q426K	probably damaging	Het

Other mutations in Igf1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Igf1r	APN	7	68190023	missense	probably benign
IGL00837:Igf1r	APN	7	68201352	splice site	probably benign
IGL01515:Igf1r	APN	7	68207452	missense	probably damaging	1.00
IGL01572:Igf1r	APN	7	68193441	missense	probably benign	0.01
IGL02100:Igf1r	APN	7	68189958	missense	probably benign	0.05
IGL02506:Igf1r	APN	7	68193396	missense	probably benign
IGL02672:Igf1r	APN	7	68190033	missense	probably benign	0.05
IGL02701:Igf1r	APN	7	68201249	missense	possibly damaging	0.93
IGL02742:Igf1r	APN	7	68189991	missense	possibly damaging	0.94
IGL03073:Igf1r	APN	7	68215043	missense	probably damaging	1.00
IGL03257:Igf1r	APN	7	68214940	missense	probably damaging	1.00
Frufru	UTSW	7	68004163	missense	probably damaging	1.00
Hungarian	UTSW	7	68214997	missense	probably damaging	1.00
Mimi	UTSW	7	68195026	missense	possibly damaging	0.67
Piroshka	UTSW	7	68207336	nonsense	probably null
Romanian	UTSW	7	68004137	missense	possibly damaging	0.94
Sublime	UTSW	7	68004179	missense	probably damaging	1.00
Toy	UTSW	7	68003972	missense	probably damaging	1.00
BB009:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
BB019:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
FR4548:Igf1r	UTSW	7	68226186	small insertion	probably benign
FR4737:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226181	small insertion	probably benign
FR4976:Igf1r	UTSW	7	68226186	small insertion	probably benign
PIT4445001:Igf1r	UTSW	7	68207463	missense	probably damaging	1.00
R0003:Igf1r	UTSW	7	68165242	missense	probably damaging	1.00
R0184:Igf1r	UTSW	7	68226193	missense	possibly damaging	0.84
R0538:Igf1r	UTSW	7	68207826	missense	probably damaging	1.00
R0632:Igf1r	UTSW	7	68165155	missense	probably damaging	1.00
R0727:Igf1r	UTSW	7	68212158	critical splice donor site	probably null
R0750:Igf1r	UTSW	7	68212091	missense	probably damaging	0.99
R1104:Igf1r	UTSW	7	68195026	missense	possibly damaging	0.67
R1169:Igf1r	UTSW	7	68165127	missense	probably benign	0.00
R1348:Igf1r	UTSW	7	68218468	missense	probably damaging	1.00
R1471:Igf1r	UTSW	7	68003837	missense	probably damaging	0.98
R1580:Igf1r	UTSW	7	68207869	missense	probably benign
R1745:Igf1r	UTSW	7	68169913	missense	probably damaging	1.00
R1772:Igf1r	UTSW	7	68195074	missense	probably benign	0.03
R1789:Igf1r	UTSW	7	68214933	nonsense	probably null
R1823:Igf1r	UTSW	7	68194981	missense	possibly damaging	0.77
R1902:Igf1r	UTSW	7	68201249	missense	possibly damaging	0.93
R1962:Igf1r	UTSW	7	68207275	missense	probably damaging	0.99
R2179:Igf1r	UTSW	7	68003950	missense	probably damaging	0.99
R2215:Igf1r	UTSW	7	68165234	missense	probably benign
R2221:Igf1r	UTSW	7	68201962	missense	probably damaging	1.00
R2233:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2234:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R2235:Igf1r	UTSW	7	68212080	missense	probably damaging	1.00
R3023:Igf1r	UTSW	7	68183399	missense	probably benign	0.00
R4044:Igf1r	UTSW	7	68190062	missense	possibly damaging	0.83
R4226:Igf1r	UTSW	7	68195078	nonsense	probably null
R4387:Igf1r	UTSW	7	68170009	missense	probably benign
R4388:Igf1r	UTSW	7	68170009	missense	probably benign
R4728:Igf1r	UTSW	7	68189624	missense	probably damaging	1.00
R4781:Igf1r	UTSW	7	68165199	missense	possibly damaging	0.75
R5254:Igf1r	UTSW	7	68207319	missense	probably damaging	0.99
R5278:Igf1r	UTSW	7	68193418	missense	possibly damaging	0.78
R5510:Igf1r	UTSW	7	68193359	missense	probably benign	0.19
R5522:Igf1r	UTSW	7	68183510	missense	probably damaging	0.96
R5527:Igf1r	UTSW	7	68207821	missense	probably damaging	1.00
R5761:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R5849:Igf1r	UTSW	7	68190033	missense	probably benign
R6189:Igf1r	UTSW	7	68207336	nonsense	probably null
R6262:Igf1r	UTSW	7	68003972	missense	probably damaging	1.00
R6285:Igf1r	UTSW	7	68004137	missense	possibly damaging	0.94
R6318:Igf1r	UTSW	7	68165233	missense	probably benign	0.02
R6365:Igf1r	UTSW	7	68190050	missense	probably benign	0.26
R6377:Igf1r	UTSW	7	68201250	missense	probably benign	0.00
R6831:Igf1r	UTSW	7	68207319	missense	possibly damaging	0.75
R6848:Igf1r	UTSW	7	68004179	missense	probably damaging	1.00
R6902:Igf1r	UTSW	7	68004163	missense	probably damaging	1.00
R7193:Igf1r	UTSW	7	68187157	missense	probably damaging	1.00
R7373:Igf1r	UTSW	7	68195078	nonsense	probably null
R7442:Igf1r	UTSW	7	68173278	missense	probably damaging	1.00
R7903:Igf1r	UTSW	7	68184752	missense	probably damaging	1.00
R7923:Igf1r	UTSW	7	68190101	missense	probably damaging	1.00
R7932:Igf1r	UTSW	7	68212054	missense	possibly damaging	0.88
R8368:Igf1r	UTSW	7	68187048	missense	probably benign	0.03
R8539:Igf1r	UTSW	7	68003848	missense	probably benign	0.06
R8704:Igf1r	UTSW	7	68170054	splice site	probably benign
R8746:Igf1r	UTSW	7	68214997	missense	probably damaging	1.00
R8829:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8832:Igf1r	UTSW	7	68226021	missense	probably damaging	1.00
R8859:Igf1r	UTSW	7	68183463	missense	possibly damaging	0.75
R9057:Igf1r	UTSW	7	68183438	missense	probably damaging	1.00
R9243:Igf1r	UTSW	7	68212027	missense	probably benign	0.11
R9342:Igf1r	UTSW	7	68194998	missense	probably benign	0.00
R9412:Igf1r	UTSW	7	68207253	missense	probably damaging	1.00
R9525:Igf1r	UTSW	7	68214934	missense	probably damaging	1.00
R9727:Igf1r	UTSW	7	68207806	missense	probably damaging	1.00
R9730:Igf1r	UTSW	7	68189675	missense	probably damaging	1.00
R9779:Igf1r	UTSW	7	68004317	missense	probably damaging	1.00
RF025:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF032:Igf1r	UTSW	7	68226179	small insertion	probably benign
RF034:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF037:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF039:Igf1r	UTSW	7	68226176	small insertion	probably benign
RF044:Igf1r	UTSW	7	68226179	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226168	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226174	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226180	small insertion	probably benign
Z1186:Igf1r	UTSW	7	68226182	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226169	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226170	small insertion	probably benign
Z1191:Igf1r	UTSW	7	68226173	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTGAAAACCACTTTTCCGG -3'
(R):5'- TGTTCTAACAGAAAACCAGAGAGC -3'

Sequencing Primer
(F):5'- GAAAACCACTTTTCCGGTATCC -3'
(R):5'- GCTTCTGAGTTCTGGCCCAG -3'

Posted On

2020-10-20