Incidental Mutation 'R8458:Chst5'
ID655126
Institutional Source Beutler Lab
Gene Symbol Chst5
Ensembl Gene ENSMUSG00000031952
Gene Namecarbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5
SynonymsGST-4, I-GlcNAc6ST
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8458 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location111889136-111910447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111890790 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 66 (V66A)
Ref Sequence ENSEMBL: ENSMUSP00000034430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034430]
Predicted Effect probably damaging
Transcript: ENSMUST00000034430
AA Change: V66A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034430
Gene: ENSMUSG00000031952
AA Change: V66A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Sulfotransfer_1 40 357 1.2e-25 PFAM
Pfam:Sulfotransfer_3 41 294 4.7e-16 PFAM
low complexity region 363 376 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that catalyzes the transfer of a sulfate group to the GlcNAc residues of keratan. Keratan sulfate helps maintain corneal transparency. Defects in this gene are a cause of macular corneal dystrophy (MCD). [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in thinner corneas that show abnormally close collagen fibrillar packing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T A 15: 94,353,640 H422L probably benign Het
Adgra3 G T 5: 49,987,671 P527T probably damaging Het
Afg1l A G 10: 42,426,521 V161A probably damaging Het
Als2cl A C 9: 110,884,957 E65A probably damaging Het
Arl3 A C 19: 46,558,270 S39A probably benign Het
Cacna1a T C 8: 84,549,458 V560A probably damaging Het
Ccr10 C T 11: 101,174,156 G183R probably damaging Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Chkb A T 15: 89,428,173 V213E possibly damaging Het
Crx C A 7: 15,868,106 A216S possibly damaging Het
Ctnnd1 T C 2: 84,613,943 D556G probably damaging Het
Cyp4a14 C A 4: 115,495,932 G61V probably damaging Het
Cyp4f17 T A 17: 32,520,576 F157L probably damaging Het
Dnah12 A T 14: 26,826,892 probably null Het
Dnah14 A C 1: 181,806,012 H4P Het
Dnah7a T C 1: 53,617,983 D878G probably benign Het
Epb41l1 C T 2: 156,521,764 T731I probably benign Het
Epg5 G C 18: 77,948,731 E214D probably benign Het
Fam171b A G 2: 83,860,520 T276A probably benign Het
Fat4 G A 3: 38,981,553 R3118H probably benign Het
Fbrs C T 7: 127,483,157 R327W probably damaging Het
Fmo3 A G 1: 162,966,940 V187A possibly damaging Het
Gins1 T C 2: 150,930,887 V190A probably benign Het
Gm17067 T C 7: 42,708,731 S116G probably damaging Het
Gm5478 A G 15: 101,645,427 V250A probably benign Het
Gpr85 T C 6: 13,836,849 T19A probably benign Het
Hepacam2 T C 6: 3,483,358 N217S probably damaging Het
Igf1r T C 7: 68,195,629 Y889H probably benign Het
Itpr2 T G 6: 146,233,966 R1822S possibly damaging Het
Kcnk7 C T 19: 5,704,379 probably benign Het
Klk1 T C 7: 44,225,509 S11P probably damaging Het
Klra7 C T 6: 130,224,146 G216R probably damaging Het
Krt34 T C 11: 100,040,075 D167G probably damaging Het
Larp1b A C 3: 40,976,560 E291D probably benign Het
Lats1 T A 10: 7,710,924 L950* probably null Het
Lrrc2 A C 9: 110,970,150 D255A probably damaging Het
Lrrc49 A T 9: 60,598,173 M605K probably benign Het
Mocos A G 18: 24,666,257 K183E probably benign Het
Mpl C A 4: 118,444,016 probably null Het
Mroh9 T A 1: 163,055,681 T410S probably damaging Het
Notch3 T C 17: 32,156,050 E430G probably damaging Het
Nsun6 T C 2: 15,030,052 T252A probably benign Het
Ntrk1 C A 3: 87,791,669 probably null Het
Nts G T 10: 102,485,060 T56N probably damaging Het
Nup210l A G 3: 90,185,567 D1276G probably null Het
Olfr1255 G T 2: 89,817,150 V269F probably damaging Het
Olfr1458 T C 19: 13,102,476 Y276C probably damaging Het
Olfr642 C A 7: 104,049,668 A229S possibly damaging Het
Osbpl8 A G 10: 111,277,316 S535G possibly damaging Het
Pax9 A G 12: 56,696,765 I66V possibly damaging Het
Pja2 A G 17: 64,292,848 V547A probably damaging Het
Plekhs1 T C 19: 56,477,158 L185S probably benign Het
Prkdc T A 16: 15,790,676 probably null Het
Ptgdr2 A T 19: 10,940,421 T101S possibly damaging Het
Ptprd T C 4: 76,066,259 D550G probably benign Het
Ptx3 G T 3: 66,220,998 R160L probably benign Het
Rdh16f1 A C 10: 127,788,845 E184A probably damaging Het
Rfx3 C T 19: 27,793,672 E560K possibly damaging Het
Scgb2b24 T C 7: 33,737,354 Q111R probably benign Het
Spg20 A G 3: 55,124,894 D383G probably damaging Het
Stpg3 C A 2: 25,213,321 R252L probably damaging Het
Tcp11l2 C T 10: 84,613,532 Q454* probably null Het
Trav10d A G 14: 52,811,323 Y57C probably damaging Het
Vmn1r170 T A 7: 23,606,896 M241K possibly damaging Het
Vwa8 T A 14: 79,064,892 N1000K probably damaging Het
Wdsub1 T C 2: 59,861,701 E329G probably benign Het
Wnk4 C A 11: 101,275,321 C891* probably null Het
Zdhhc16 G T 19: 41,939,654 C204F probably damaging Het
Zfp868 T C 8: 69,611,908 I259V possibly damaging Het
Zranb3 G T 1: 127,992,910 Q426K probably damaging Het
Other mutations in Chst5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Chst5 APN 8 111890682 missense probably damaging 1.00
IGL02336:Chst5 APN 8 111890317 missense probably damaging 0.99
IGL02634:Chst5 APN 8 111890845 missense probably damaging 1.00
R0606:Chst5 UTSW 8 111890919 missense probably benign 0.05
R1552:Chst5 UTSW 8 111890280 missense probably damaging 0.99
R2094:Chst5 UTSW 8 111890544 missense probably benign 0.01
R3769:Chst5 UTSW 8 111889881 missense possibly damaging 0.67
R4135:Chst5 UTSW 8 111890184 missense probably damaging 1.00
R4872:Chst5 UTSW 8 111890560 missense possibly damaging 0.61
R5658:Chst5 UTSW 8 111890790 missense probably damaging 1.00
R5759:Chst5 UTSW 8 111890210 missense probably benign 0.25
R5893:Chst5 UTSW 8 111890196 missense probably damaging 1.00
R6657:Chst5 UTSW 8 111890274 missense probably benign 0.00
R6731:Chst5 UTSW 8 111890044 missense probably benign 0.00
R7406:Chst5 UTSW 8 111890613 missense probably benign 0.00
R7535:Chst5 UTSW 8 111890163 missense probably damaging 1.00
R7727:Chst5 UTSW 8 111890925 missense probably benign 0.25
R7835:Chst5 UTSW 8 111890602 missense probably damaging 1.00
R7843:Chst5 UTSW 8 111890572 missense probably benign 0.00
R8257:Chst5 UTSW 8 111890460 missense probably damaging 1.00
R8324:Chst5 UTSW 8 111890508 missense probably benign 0.06
R8444:Chst5 UTSW 8 111890763 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTATAGGAGCTGCAGGC -3'
(R):5'- CATGCTTTCGCTCCTGATGG -3'

Sequencing Primer
(F):5'- TTGCGCACAGAGGCTTACAC -3'
(R):5'- TGGTACAGACTGGCATCCTG -3'
Posted On2020-10-20