Incidental Mutation 'R8458:Vwa8'
ID655142
Institutional Source Beutler Lab
Gene Symbol Vwa8
Ensembl Gene ENSMUSG00000058997
Gene Namevon Willebrand factor A domain containing 8
Synonyms4932416F07Rik, 1300010F03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8458 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location78849052-79202310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79064892 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1000 (N1000K)
Ref Sequence ENSEMBL: ENSMUSP00000048925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040990] [ENSMUST00000227255]
Predicted Effect probably damaging
Transcript: ENSMUST00000040990
AA Change: N1000K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048925
Gene: ENSMUSG00000058997
AA Change: N1000K

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 20 33 N/A INTRINSIC
Pfam:AAA_5 104 260 6.3e-44 PFAM
AAA 438 613 4.69e-2 SMART
AAA 772 904 1.26e-1 SMART
low complexity region 1213 1221 N/A INTRINSIC
low complexity region 1565 1586 N/A INTRINSIC
VWA 1712 1901 2.71e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000227255
AA Change: N1000K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T A 15: 94,353,640 H422L probably benign Het
Adgra3 G T 5: 49,987,671 P527T probably damaging Het
Afg1l A G 10: 42,426,521 V161A probably damaging Het
Als2cl A C 9: 110,884,957 E65A probably damaging Het
Arl3 A C 19: 46,558,270 S39A probably benign Het
Cacna1a T C 8: 84,549,458 V560A probably damaging Het
Ccr10 C T 11: 101,174,156 G183R probably damaging Het
Celsr2 T A 3: 108,398,902 T2029S probably benign Het
Chkb A T 15: 89,428,173 V213E possibly damaging Het
Chst5 A G 8: 111,890,790 V66A probably damaging Het
Crx C A 7: 15,868,106 A216S possibly damaging Het
Ctnnd1 T C 2: 84,613,943 D556G probably damaging Het
Cyp4a14 C A 4: 115,495,932 G61V probably damaging Het
Cyp4f17 T A 17: 32,520,576 F157L probably damaging Het
Dnah12 A T 14: 26,826,892 probably null Het
Dnah14 A C 1: 181,806,012 H4P Het
Dnah7a T C 1: 53,617,983 D878G probably benign Het
Epb41l1 C T 2: 156,521,764 T731I probably benign Het
Epg5 G C 18: 77,948,731 E214D probably benign Het
Fam171b A G 2: 83,860,520 T276A probably benign Het
Fat4 G A 3: 38,981,553 R3118H probably benign Het
Fbrs C T 7: 127,483,157 R327W probably damaging Het
Fmo3 A G 1: 162,966,940 V187A possibly damaging Het
Gins1 T C 2: 150,930,887 V190A probably benign Het
Gm17067 T C 7: 42,708,731 S116G probably damaging Het
Gm5478 A G 15: 101,645,427 V250A probably benign Het
Gpr85 T C 6: 13,836,849 T19A probably benign Het
Hepacam2 T C 6: 3,483,358 N217S probably damaging Het
Igf1r T C 7: 68,195,629 Y889H probably benign Het
Itpr2 T G 6: 146,233,966 R1822S possibly damaging Het
Kcnk7 C T 19: 5,704,379 probably benign Het
Klk1 T C 7: 44,225,509 S11P probably damaging Het
Klra7 C T 6: 130,224,146 G216R probably damaging Het
Krt34 T C 11: 100,040,075 D167G probably damaging Het
Larp1b A C 3: 40,976,560 E291D probably benign Het
Lats1 T A 10: 7,710,924 L950* probably null Het
Lrrc2 A C 9: 110,970,150 D255A probably damaging Het
Lrrc49 A T 9: 60,598,173 M605K probably benign Het
Mocos A G 18: 24,666,257 K183E probably benign Het
Mpl C A 4: 118,444,016 probably null Het
Mroh9 T A 1: 163,055,681 T410S probably damaging Het
Notch3 T C 17: 32,156,050 E430G probably damaging Het
Nsun6 T C 2: 15,030,052 T252A probably benign Het
Ntrk1 C A 3: 87,791,669 probably null Het
Nts G T 10: 102,485,060 T56N probably damaging Het
Nup210l A G 3: 90,185,567 D1276G probably null Het
Olfr1255 G T 2: 89,817,150 V269F probably damaging Het
Olfr1458 T C 19: 13,102,476 Y276C probably damaging Het
Olfr642 C A 7: 104,049,668 A229S possibly damaging Het
Osbpl8 A G 10: 111,277,316 S535G possibly damaging Het
Pax9 A G 12: 56,696,765 I66V possibly damaging Het
Pja2 A G 17: 64,292,848 V547A probably damaging Het
Plekhs1 T C 19: 56,477,158 L185S probably benign Het
Prkdc T A 16: 15,790,676 probably null Het
Ptgdr2 A T 19: 10,940,421 T101S possibly damaging Het
Ptprd T C 4: 76,066,259 D550G probably benign Het
Ptx3 G T 3: 66,220,998 R160L probably benign Het
Rdh16f1 A C 10: 127,788,845 E184A probably damaging Het
Rfx3 C T 19: 27,793,672 E560K possibly damaging Het
Scgb2b24 T C 7: 33,737,354 Q111R probably benign Het
Spg20 A G 3: 55,124,894 D383G probably damaging Het
Stpg3 C A 2: 25,213,321 R252L probably damaging Het
Tcp11l2 C T 10: 84,613,532 Q454* probably null Het
Trav10d A G 14: 52,811,323 Y57C probably damaging Het
Vmn1r170 T A 7: 23,606,896 M241K possibly damaging Het
Wdsub1 T C 2: 59,861,701 E329G probably benign Het
Wnk4 C A 11: 101,275,321 C891* probably null Het
Zdhhc16 G T 19: 41,939,654 C204F probably damaging Het
Zfp868 T C 8: 69,611,908 I259V possibly damaging Het
Zranb3 G T 1: 127,992,910 Q426K probably damaging Het
Other mutations in Vwa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Vwa8 APN 14 79038195 missense probably damaging 1.00
IGL01087:Vwa8 APN 14 78935229 missense probably benign 0.16
IGL01137:Vwa8 APN 14 79103647 missense probably damaging 1.00
IGL01359:Vwa8 APN 14 79064913 nonsense probably null
IGL01449:Vwa8 APN 14 79182988 nonsense probably null
IGL01604:Vwa8 APN 14 79180804 missense possibly damaging 0.82
IGL01636:Vwa8 APN 14 79198354 missense possibly damaging 0.68
IGL01815:Vwa8 APN 14 79198277 missense possibly damaging 0.92
IGL02024:Vwa8 APN 14 79094284 missense possibly damaging 0.91
IGL02033:Vwa8 APN 14 78984209 missense possibly damaging 0.89
IGL02154:Vwa8 APN 14 78849293 missense possibly damaging 0.53
IGL02286:Vwa8 APN 14 78947273 critical splice donor site probably null
IGL02393:Vwa8 APN 14 79182977 missense probably damaging 1.00
IGL02430:Vwa8 APN 14 78934645 critical splice donor site probably null
IGL02476:Vwa8 APN 14 78925341 missense possibly damaging 0.62
IGL02612:Vwa8 APN 14 79183112 missense probably benign 0.01
IGL02678:Vwa8 APN 14 78984200 missense probably damaging 0.99
IGL02797:Vwa8 APN 14 78925262 missense probably benign 0.29
IGL02806:Vwa8 APN 14 79157088 missense probably benign 0.35
IGL02811:Vwa8 APN 14 78994459 missense probably benign 0.21
IGL02892:Vwa8 APN 14 79103700 splice site probably benign
IGL03024:Vwa8 APN 14 78995098 missense probably benign 0.03
IGL03075:Vwa8 APN 14 78933756 missense probably damaging 0.99
IGL03090:Vwa8 APN 14 78934601 missense possibly damaging 0.92
IGL03124:Vwa8 APN 14 79058815 splice site probably benign
IGL03181:Vwa8 APN 14 79009250 missense probably benign 0.01
IGL03296:Vwa8 APN 14 79183100 missense probably damaging 0.98
IGL03376:Vwa8 APN 14 79183134 splice site probably null
R6812_Vwa8_870 UTSW 14 79197419 missense probably damaging 0.99
IGL03052:Vwa8 UTSW 14 79064921 missense probably benign 0.02
PIT4468001:Vwa8 UTSW 14 79183061 missense probably damaging 1.00
R0049:Vwa8 UTSW 14 79093739 missense probably benign 0.21
R0063:Vwa8 UTSW 14 79164216 splice site probably benign
R0063:Vwa8 UTSW 14 79164216 splice site probably benign
R0081:Vwa8 UTSW 14 79082782 missense probably benign 0.02
R0305:Vwa8 UTSW 14 79009273 missense probably damaging 1.00
R0433:Vwa8 UTSW 14 79062676 missense probably damaging 1.00
R0514:Vwa8 UTSW 14 78947189 missense probably benign
R0602:Vwa8 UTSW 14 79020620 missense probably benign 0.00
R0615:Vwa8 UTSW 14 78908150 missense probably benign
R0791:Vwa8 UTSW 14 78994576 splice site probably benign
R1028:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1037:Vwa8 UTSW 14 79086654 nonsense probably null
R1404:Vwa8 UTSW 14 79026031 missense probably damaging 1.00
R1404:Vwa8 UTSW 14 79026031 missense probably damaging 1.00
R1412:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1421:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1467:Vwa8 UTSW 14 79103694 nonsense probably null
R1467:Vwa8 UTSW 14 79103694 nonsense probably null
R1539:Vwa8 UTSW 14 79062562 missense probably benign 0.00
R1556:Vwa8 UTSW 14 79086681 missense probably benign
R1589:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1590:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1591:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1645:Vwa8 UTSW 14 79182987 missense probably damaging 1.00
R1673:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1688:Vwa8 UTSW 14 79201103 missense possibly damaging 0.72
R1764:Vwa8 UTSW 14 78908195 missense probably damaging 1.00
R1830:Vwa8 UTSW 14 79081136 missense probably benign 0.04
R1926:Vwa8 UTSW 14 79020635 missense probably benign 0.00
R1959:Vwa8 UTSW 14 78982360 missense possibly damaging 0.95
R1971:Vwa8 UTSW 14 78925254 splice site probably benign
R2078:Vwa8 UTSW 14 78908157 missense probably damaging 1.00
R2103:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R2230:Vwa8 UTSW 14 79092403 critical splice donor site probably null
R2281:Vwa8 UTSW 14 79064996 missense possibly damaging 0.91
R2313:Vwa8 UTSW 14 78912218 missense probably damaging 0.98
R2847:Vwa8 UTSW 14 78947142 missense probably benign 0.00
R2848:Vwa8 UTSW 14 78947142 missense probably benign 0.00
R2894:Vwa8 UTSW 14 79038138 missense probably damaging 1.00
R2991:Vwa8 UTSW 14 78995149 missense probably benign 0.00
R3077:Vwa8 UTSW 14 79098342 missense probably benign 0.03
R3405:Vwa8 UTSW 14 79164220 splice site probably benign
R3406:Vwa8 UTSW 14 79164220 splice site probably benign
R3708:Vwa8 UTSW 14 79062696 splice site probably benign
R3779:Vwa8 UTSW 14 79102322 splice site probably benign
R3799:Vwa8 UTSW 14 79064896 missense probably damaging 0.99
R4230:Vwa8 UTSW 14 79082852 missense probably benign 0.00
R4425:Vwa8 UTSW 14 79082806 missense probably benign 0.00
R4478:Vwa8 UTSW 14 78868801 missense probably benign 0.00
R4627:Vwa8 UTSW 14 79103697 critical splice donor site probably null
R4835:Vwa8 UTSW 14 78934613 missense probably benign 0.11
R4868:Vwa8 UTSW 14 79183082 missense probably damaging 1.00
R4988:Vwa8 UTSW 14 79198283 missense probably benign 0.05
R5137:Vwa8 UTSW 14 79064902 missense probably damaging 1.00
R5156:Vwa8 UTSW 14 78984226 missense probably benign 0.00
R5658:Vwa8 UTSW 14 78982398 critical splice donor site probably null
R5841:Vwa8 UTSW 14 78994518 missense probably benign
R6057:Vwa8 UTSW 14 79082873 missense probably benign 0.21
R6244:Vwa8 UTSW 14 79086662 missense probably benign
R6264:Vwa8 UTSW 14 79086812 missense possibly damaging 0.64
R6290:Vwa8 UTSW 14 79094332 splice site probably null
R6332:Vwa8 UTSW 14 79197464 missense probably benign
R6395:Vwa8 UTSW 14 79093744 missense probably benign 0.02
R6472:Vwa8 UTSW 14 79009170 missense possibly damaging 0.71
R6497:Vwa8 UTSW 14 79096401 missense probably benign 0.00
R6527:Vwa8 UTSW 14 78947213 missense possibly damaging 0.73
R6552:Vwa8 UTSW 14 79198222 missense possibly damaging 0.80
R6812:Vwa8 UTSW 14 79197419 missense probably damaging 0.99
R6994:Vwa8 UTSW 14 78908156 missense possibly damaging 0.90
R7040:Vwa8 UTSW 14 78912205 missense probably damaging 1.00
R7357:Vwa8 UTSW 14 79038201 missense probably null 1.00
R7363:Vwa8 UTSW 14 79018707 missense probably benign 0.05
R7381:Vwa8 UTSW 14 79095685 missense probably benign 0.00
R7406:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7408:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7409:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7410:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7483:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7484:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7491:Vwa8 UTSW 14 79082814 missense probably benign 0.24
R7500:Vwa8 UTSW 14 78925246 splice site probably null
R7514:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7582:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7584:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7585:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7647:Vwa8 UTSW 14 78935229 missense probably damaging 0.99
R7685:Vwa8 UTSW 14 79098300 missense probably benign
R7703:Vwa8 UTSW 14 79026073 missense probably damaging 1.00
R7730:Vwa8 UTSW 14 78995149 missense probably benign 0.00
R7775:Vwa8 UTSW 14 79038147 missense probably benign 0.03
R7778:Vwa8 UTSW 14 79038147 missense probably benign 0.03
R7824:Vwa8 UTSW 14 79038147 missense probably benign 0.03
R7885:Vwa8 UTSW 14 79020649 missense probably benign 0.00
R7902:Vwa8 UTSW 14 79092291 missense probably benign 0.00
R8262:Vwa8 UTSW 14 78933832 critical splice donor site probably null
R8495:Vwa8 UTSW 14 78937177 nonsense probably null
R8557:Vwa8 UTSW 14 79009209 missense probably damaging 1.00
R8841:Vwa8 UTSW 14 78947262 missense probably benign 0.04
Z1088:Vwa8 UTSW 14 78982246 missense probably benign 0.38
Z1177:Vwa8 UTSW 14 79058692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGCTTATCAGACACAGCTAG -3'
(R):5'- AACACTACTGCTGAGGGCTTC -3'

Sequencing Primer
(F):5'- ACAGCTAGTGCGTTTCTGC -3'
(R):5'- CAGCTTAGTAGTGTCTACAGCAG -3'
Posted On2020-10-20