Incidental Mutation 'R8459:Spata16'
ID655167
Institutional Source Beutler Lab
Gene Symbol Spata16
Ensembl Gene ENSMUSG00000039335
Gene Namespermatogenesis associated 16
Synonymsspermatogenesis-related protein, 4921511F01Rik, 4930503K02Rik, Nyd-sp12
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R8459 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location26637620-26983212 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26667527 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 66 (T66A)
Ref Sequence ENSEMBL: ENSMUSP00000043378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047005] [ENSMUST00000108305]
Predicted Effect probably benign
Transcript: ENSMUST00000047005
AA Change: T66A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043378
Gene: ENSMUSG00000039335
AA Change: T66A

DomainStartEndE-ValueType
Pfam:NYD-SP12_N 5 569 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108305
AA Change: T66A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103941
Gene: ENSMUSG00000039335
AA Change: T66A

DomainStartEndE-ValueType
Pfam:NYD-SP12_N 1 534 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a testis-specific protein that belongs to the tetratricopeptide repeat-like superfamily. The encoded protein localizes to the Golgi apparatus and may play a role in spermatogenesis. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 A G 4: 58,821,379 V1207A probably damaging Het
Aim2 CTTGTTGT CTTGT 1: 173,461,970 probably benign Het
Ank1 T C 8: 23,115,512 V1132A probably damaging Het
Bpifb9a T G 2: 154,260,233 S83R probably damaging Het
Cacnb3 C T 15: 98,639,512 R24C probably damaging Het
Car8 C T 4: 8,189,302 V171I probably benign Het
Cdk17 G C 10: 93,232,427 V349L probably damaging Het
Celsr3 A G 9: 108,829,630 E1104G probably damaging Het
Chml T C 1: 175,688,031 D108G probably benign Het
Cluap1 T C 16: 3,937,589 M356T probably damaging Het
Cmtm1 A G 8: 104,309,511 V162A possibly damaging Het
Cryge T C 1: 65,048,682 D156G possibly damaging Het
Disc1 A C 8: 125,165,155 D649A possibly damaging Het
Dnah8 T C 17: 30,725,247 probably null Het
Dpp7 C A 2: 25,352,538 V468F probably damaging Het
Ep400 A G 5: 110,708,891 F1163S unknown Het
Fbrs C T 7: 127,483,157 R327W probably damaging Het
Fsip2 T A 2: 82,979,678 Y2114N possibly damaging Het
Gm609 T A 16: 45,417,908 H294L probably benign Het
Gm6205 A G 5: 94,682,883 D80G probably damaging Het
Gnas A T 2: 174,284,939 H89L probably benign Het
Gstt1 G A 10: 75,794,109 R107W probably damaging Het
Hal A G 10: 93,516,315 D656G probably benign Het
Htra3 G A 5: 35,671,225 probably benign Het
Ighv1-64 G A 12: 115,507,636 A87V probably benign Het
Itga3 A G 11: 95,068,807 V80A probably benign Het
Lrrc58 A G 16: 37,878,510 N280D probably benign Het
Macf1 T C 4: 123,480,314 E1501G possibly damaging Het
Madd A G 2: 91,162,526 I1016T probably benign Het
Mbnl1 T G 3: 60,622,207 S260R probably damaging Het
Olfr183 A T 16: 58,999,985 Q100L probably damaging Het
Phip G T 9: 82,876,053 A1529D probably benign Het
Prorsd1 T C 11: 29,513,286 T159A probably damaging Het
Sh3tc1 C A 5: 35,721,589 R67L probably benign Het
Skint5 A T 4: 113,846,284 L518* probably null Het
Slc26a11 T A 11: 119,368,817 I280N possibly damaging Het
Syne1 G A 10: 5,424,277 R177* probably null Het
Vmn1r16 A C 6: 57,323,362 C92G probably benign Het
Vmn1r50 A G 6: 90,107,253 probably benign Het
Other mutations in Spata16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Spata16 APN 3 26924262 missense probably damaging 0.98
IGL01017:Spata16 APN 3 26840722 missense possibly damaging 0.93
IGL01129:Spata16 APN 3 26913184 splice site probably benign
IGL01330:Spata16 APN 3 26914715 missense probably damaging 0.99
IGL02033:Spata16 APN 3 26913334 critical splice donor site probably null
IGL02069:Spata16 APN 3 26732795 nonsense probably null
IGL02231:Spata16 APN 3 26913264 missense probably damaging 1.00
R0084:Spata16 UTSW 3 26667410 missense possibly damaging 0.95
R0109:Spata16 UTSW 3 26913267 missense probably damaging 0.97
R0109:Spata16 UTSW 3 26913267 missense probably damaging 0.97
R0325:Spata16 UTSW 3 26667456 missense probably damaging 0.98
R0811:Spata16 UTSW 3 26913338 splice site probably benign
R2061:Spata16 UTSW 3 26924370 missense probably damaging 0.99
R3148:Spata16 UTSW 3 26878712 critical splice donor site probably null
R4837:Spata16 UTSW 3 26732932 missense possibly damaging 0.93
R4972:Spata16 UTSW 3 26840723 missense possibly damaging 0.93
R5129:Spata16 UTSW 3 26667564 missense probably damaging 0.98
R5235:Spata16 UTSW 3 26667632 missense probably benign 0.00
R5458:Spata16 UTSW 3 26777537 missense probably damaging 0.99
R6578:Spata16 UTSW 3 26667548 nonsense probably null
R7069:Spata16 UTSW 3 26927334 missense probably damaging 0.99
R7256:Spata16 UTSW 3 26667867 missense probably benign 0.25
R7936:Spata16 UTSW 3 26667423 missense possibly damaging 0.71
R8015:Spata16 UTSW 3 26667659 missense probably benign
R8060:Spata16 UTSW 3 26840720 missense probably damaging 0.99
R8161:Spata16 UTSW 3 26840662 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TACGGGTGGACCAATGGATTC -3'
(R):5'- AGACCAGCTTCATTTCCACATC -3'

Sequencing Primer
(F):5'- TGGACCAATGGATTCTGGCAAG -3'
(R):5'- CATCCATTATGTTCTTTAAGGGGATG -3'
Posted On2020-10-20