Mutagenetix > Incidental Mutations

Incidental Mutation 'R8459:Ep400'

655176

Institutional Source

Beutler Lab

Gene Symbol

Ep400

Ensembl Gene

ENSMUSG00000029505

Gene Name

E1A binding protein p400

Synonyms

mDomino, 1700020J09Rik, p400

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8459 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110664373-110770717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110708891 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1163 (F1163S)

Ref Sequence

ENSEMBL: ENSMUSP00000049038 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041558] [ENSMUST00000112435] [ENSMUST00000112436]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000041558
AA Change: F1163S

SMART Domains

Protein: ENSMUSP00000049038
Gene: ENSMUSG00000029505
AA Change: F1163S

Domain	Start	End	E-Value	Type
Pfam:EP400_N	1	461	1.6e-232	PFAM
low complexity region	519	532	N/A	INTRINSIC
low complexity region	550	561	N/A	INTRINSIC
low complexity region	598	620	N/A	INTRINSIC
low complexity region	631	645	N/A	INTRINSIC
low complexity region	658	686	N/A	INTRINSIC
HSA	762	833	1.31e-31	SMART
low complexity region	908	925	N/A	INTRINSIC
DEXDc	1049	1238	2.76e-15	SMART
Blast:DEXDc	1276	1317	2e-15	BLAST
low complexity region	1407	1417	N/A	INTRINSIC
HELICc	1807	1893	1.17e-4	SMART
low complexity region	2006	2019	N/A	INTRINSIC
low complexity region	2080	2100	N/A	INTRINSIC
low complexity region	2214	2223	N/A	INTRINSIC
SANT	2243	2310	3.57e-1	SMART
low complexity region	2402	2489	N/A	INTRINSIC
low complexity region	2596	2608	N/A	INTRINSIC
low complexity region	2644	2679	N/A	INTRINSIC
low complexity region	2694	2738	N/A	INTRINSIC
low complexity region	2769	2806	N/A	INTRINSIC
low complexity region	2846	2883	N/A	INTRINSIC
low complexity region	2933	2947	N/A	INTRINSIC
low complexity region	2974	2986	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000112435
AA Change: F1200S

SMART Domains

Protein: ENSMUSP00000108054
Gene: ENSMUSG00000029505
AA Change: F1200S

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
low complexity region	121	145	N/A	INTRINSIC
low complexity region	262	287	N/A	INTRINSIC
low complexity region	298	308	N/A	INTRINSIC
low complexity region	313	329	N/A	INTRINSIC
coiled coil region	418	447	N/A	INTRINSIC
low complexity region	471	485	N/A	INTRINSIC
low complexity region	556	569	N/A	INTRINSIC
low complexity region	587	598	N/A	INTRINSIC
low complexity region	635	657	N/A	INTRINSIC
low complexity region	668	682	N/A	INTRINSIC
low complexity region	695	723	N/A	INTRINSIC
HSA	799	870	1.31e-31	SMART
low complexity region	945	962	N/A	INTRINSIC
DEXDc	1086	1275	2.76e-15	SMART
Blast:DEXDc	1313	1354	2e-15	BLAST
low complexity region	1444	1454	N/A	INTRINSIC
internal_repeat_1	1556	1646	6.82e-5	PROSPERO
low complexity region	1887	1900	N/A	INTRINSIC
low complexity region	1961	1981	N/A	INTRINSIC
low complexity region	2095	2104	N/A	INTRINSIC
SANT	2124	2191	3.57e-1	SMART
low complexity region	2283	2370	N/A	INTRINSIC
internal_repeat_1	2371	2463	6.82e-5	PROSPERO
low complexity region	2477	2489	N/A	INTRINSIC
low complexity region	2525	2560	N/A	INTRINSIC
low complexity region	2575	2619	N/A	INTRINSIC
low complexity region	2645	2659	N/A	INTRINSIC
low complexity region	2660	2680	N/A	INTRINSIC
low complexity region	2720	2757	N/A	INTRINSIC
low complexity region	2807	2821	N/A	INTRINSIC
low complexity region	2848	2860	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000112436
AA Change: F1127S

SMART Domains

Protein: ENSMUSP00000108055
Gene: ENSMUSG00000029505
AA Change: F1127S

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
low complexity region	121	145	N/A	INTRINSIC
low complexity region	262	287	N/A	INTRINSIC
low complexity region	298	308	N/A	INTRINSIC
low complexity region	313	329	N/A	INTRINSIC
coiled coil region	418	449	N/A	INTRINSIC
low complexity region	472	482	N/A	INTRINSIC
low complexity region	483	496	N/A	INTRINSIC
low complexity region	514	525	N/A	INTRINSIC
low complexity region	562	584	N/A	INTRINSIC
low complexity region	595	609	N/A	INTRINSIC
low complexity region	622	650	N/A	INTRINSIC
HSA	726	797	1.31e-31	SMART
low complexity region	872	889	N/A	INTRINSIC
DEXDc	1013	1202	2.76e-15	SMART
Blast:DEXDc	1240	1281	2e-15	BLAST
low complexity region	1371	1381	N/A	INTRINSIC
internal_repeat_1	1483	1573	6.76e-5	PROSPERO
HELICc	1771	1857	1.17e-4	SMART
low complexity region	1970	1983	N/A	INTRINSIC
low complexity region	2044	2064	N/A	INTRINSIC
low complexity region	2178	2187	N/A	INTRINSIC
SANT	2207	2274	3.57e-1	SMART
low complexity region	2366	2453	N/A	INTRINSIC
internal_repeat_1	2454	2546	6.76e-5	PROSPERO
low complexity region	2560	2572	N/A	INTRINSIC
low complexity region	2608	2643	N/A	INTRINSIC
low complexity region	2658	2702	N/A	INTRINSIC
low complexity region	2733	2770	N/A	INTRINSIC
low complexity region	2810	2847	N/A	INTRINSIC
low complexity region	2897	2911	N/A	INTRINSIC
low complexity region	2938	2950	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125325

SMART Domains

Protein: ENSMUSP00000116137
Gene: ENSMUSG00000029505

Domain	Start	End	E-Value	Type
low complexity region	107	117	N/A	INTRINSIC
low complexity region	223	239	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele die at E11.5 and display severe defects in yolk sac erythropoiesis, anemia, and a slight deformity of the neural tube. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI314180	A	G	4: 58,821,379	V1207A	probably damaging	Het
Aim2	CTTGTTGT	CTTGT	1: 173,461,970		probably benign	Het
Ank1	T	C	8: 23,115,512	V1132A	probably damaging	Het
Bpifb9a	T	G	2: 154,260,233	S83R	probably damaging	Het
Cacnb3	C	T	15: 98,639,512	R24C	probably damaging	Het
Car8	C	T	4: 8,189,302	V171I	probably benign	Het
Cdk17	G	C	10: 93,232,427	V349L	probably damaging	Het
Celsr3	A	G	9: 108,829,630	E1104G	probably damaging	Het
Chml	T	C	1: 175,688,031	D108G	probably benign	Het
Cluap1	T	C	16: 3,937,589	M356T	probably damaging	Het
Cmtm1	A	G	8: 104,309,511	V162A	possibly damaging	Het
Cryge	T	C	1: 65,048,682	D156G	possibly damaging	Het
Disc1	A	C	8: 125,165,155	D649A	possibly damaging	Het
Dnah8	T	C	17: 30,725,247		probably null	Het
Dpp7	C	A	2: 25,352,538	V468F	probably damaging	Het
Fbrs	C	T	7: 127,483,157	R327W	probably damaging	Het
Fsip2	T	A	2: 82,979,678	Y2114N	possibly damaging	Het
Gm609	T	A	16: 45,417,908	H294L	probably benign	Het
Gm6205	A	G	5: 94,682,883	D80G	probably damaging	Het
Gnas	A	T	2: 174,284,939	H89L	probably benign	Het
Gstt1	G	A	10: 75,794,109	R107W	probably damaging	Het
Hal	A	G	10: 93,516,315	D656G	probably benign	Het
Htra3	G	A	5: 35,671,225		probably benign	Het
Ighv1-64	G	A	12: 115,507,636	A87V	probably benign	Het
Itga3	A	G	11: 95,068,807	V80A	probably benign	Het
Lrrc58	A	G	16: 37,878,510	N280D	probably benign	Het
Macf1	T	C	4: 123,480,314	E1501G	possibly damaging	Het
Madd	A	G	2: 91,162,526	I1016T	probably benign	Het
Mbnl1	T	G	3: 60,622,207	S260R	probably damaging	Het
Olfr183	A	T	16: 58,999,985	Q100L	probably damaging	Het
Phip	G	T	9: 82,876,053	A1529D	probably benign	Het
Prorsd1	T	C	11: 29,513,286	T159A	probably damaging	Het
Sh3tc1	C	A	5: 35,721,589	R67L	probably benign	Het
Skint5	A	T	4: 113,846,284	L518*	probably null	Het
Slc26a11	T	A	11: 119,368,817	I280N	possibly damaging	Het
Spata16	A	G	3: 26,667,527	T66A	probably benign	Het
Syne1	G	A	10: 5,424,277	R177*	probably null	Het
Vmn1r16	A	C	6: 57,323,362	C92G	probably benign	Het
Vmn1r50	A	G	6: 90,107,253		probably benign	Het

Other mutations in Ep400

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ep400	APN	5	110687841	missense	unknown
IGL00585:Ep400	APN	5	110755905	missense	possibly damaging	0.70
IGL00586:Ep400	APN	5	110739594	missense	probably damaging	1.00
IGL00816:Ep400	APN	5	110735490	unclassified	probably benign
IGL01066:Ep400	APN	5	110668199	splice site	probably benign
IGL01302:Ep400	APN	5	110742048	missense	probably benign	0.00
IGL01568:Ep400	APN	5	110719495	missense	unknown
IGL01833:Ep400	APN	5	110680008	missense	unknown
IGL02086:Ep400	APN	5	110676943	splice site	probably benign
IGL02266:Ep400	APN	5	110695297	unclassified	probably benign
IGL02288:Ep400	APN	5	110683836	splice site	probably benign
IGL02301:Ep400	APN	5	110674960	missense	probably damaging	1.00
IGL02377:Ep400	APN	5	110720825	missense	unknown
IGL02382:Ep400	APN	5	110701728	missense	unknown
IGL02419:Ep400	APN	5	110697376	splice site	probably null
IGL02591:Ep400	APN	5	110733772	unclassified	probably benign
IGL02981:Ep400	APN	5	110756103	missense	possibly damaging	0.79
IGL02981:Ep400	APN	5	110691610	splice site	probably benign
IGL03173:Ep400	APN	5	110708871	unclassified	probably benign
IGL03244:Ep400	APN	5	110727563	missense	unknown
IGL03333:Ep400	APN	5	110703566	missense	unknown
santol	UTSW	5	110701671	missense	unknown
PIT4243001:Ep400	UTSW	5	110735580	missense	unknown
PIT4260001:Ep400	UTSW	5	110693171	nonsense	probably null
R0017:Ep400	UTSW	5	110673529	missense	probably damaging	1.00
R0179:Ep400	UTSW	5	110668649	missense	probably damaging	0.99
R0243:Ep400	UTSW	5	110724407	splice site	probably benign
R0366:Ep400	UTSW	5	110701671	missense	unknown
R0508:Ep400	UTSW	5	110739508	missense	probably benign	0.00
R0541:Ep400	UTSW	5	110705016	missense	unknown
R0558:Ep400	UTSW	5	110685067	splice site	probably benign
R0576:Ep400	UTSW	5	110711093	unclassified	probably benign
R0595:Ep400	UTSW	5	110703542	missense	unknown
R0671:Ep400	UTSW	5	110688196	missense	unknown
R0763:Ep400	UTSW	5	110665837	missense	probably damaging	1.00
R1078:Ep400	UTSW	5	110735522	unclassified	probably benign
R1300:Ep400	UTSW	5	110673560	missense	probably damaging	1.00
R1439:Ep400	UTSW	5	110685478	missense	unknown
R1520:Ep400	UTSW	5	110691778	intron	probably benign
R1529:Ep400	UTSW	5	110739445	missense	probably benign	0.00
R1535:Ep400	UTSW	5	110708166	unclassified	probably benign
R1560:Ep400	UTSW	5	110671106	splice site	probably null
R1587:Ep400	UTSW	5	110726902	missense	probably benign	0.23
R1596:Ep400	UTSW	5	110708861	unclassified	probably benign
R1653:Ep400	UTSW	5	110693174	nonsense	probably null
R1711:Ep400	UTSW	5	110693308	unclassified	probably benign
R1774:Ep400	UTSW	5	110685491	missense	unknown
R1836:Ep400	UTSW	5	110705054	missense	unknown
R1905:Ep400	UTSW	5	110670948	missense	probably damaging	1.00
R1917:Ep400	UTSW	5	110703575	missense	unknown
R2064:Ep400	UTSW	5	110735404	unclassified	probably benign
R2122:Ep400	UTSW	5	110708850	unclassified	probably benign
R2144:Ep400	UTSW	5	110703518	missense	unknown
R2215:Ep400	UTSW	5	110693555	unclassified	probably benign
R2252:Ep400	UTSW	5	110719091	missense	unknown
R2253:Ep400	UTSW	5	110719091	missense	unknown
R2483:Ep400	UTSW	5	110719236	missense	unknown
R2504:Ep400	UTSW	5	110668645	missense	probably damaging	1.00
R2512:Ep400	UTSW	5	110708915	unclassified	probably benign
R2842:Ep400	UTSW	5	110698815	nonsense	probably null
R2920:Ep400	UTSW	5	110755914	missense	probably damaging	1.00
R3082:Ep400	UTSW	5	110693230	unclassified	probably benign
R3151:Ep400	UTSW	5	110703569	missense	unknown
R3552:Ep400	UTSW	5	110729287	missense	unknown
R3623:Ep400	UTSW	5	110719236	missense	unknown
R3779:Ep400	UTSW	5	110691649	missense	unknown
R3923:Ep400	UTSW	5	110756523	missense	possibly damaging	0.55
R4062:Ep400	UTSW	5	110741981	missense	probably benign	0.10
R4508:Ep400	UTSW	5	110703615	missense	unknown
R4584:Ep400	UTSW	5	110733897	unclassified	probably benign
R4585:Ep400	UTSW	5	110753859	missense	probably damaging	1.00
R4586:Ep400	UTSW	5	110753859	missense	probably damaging	1.00
R4807:Ep400	UTSW	5	110695578	splice site	probably null
R4921:Ep400	UTSW	5	110665810	missense	probably damaging	1.00
R4976:Ep400	UTSW	5	110698812	missense	unknown
R4976:Ep400	UTSW	5	110720756	missense	unknown
R5075:Ep400	UTSW	5	110685485	missense	unknown
R5120:Ep400	UTSW	5	110756358	missense	probably damaging	1.00
R5122:Ep400	UTSW	5	110668170	missense	probably damaging	1.00
R5223:Ep400	UTSW	5	110668630	missense	probably damaging	1.00
R5284:Ep400	UTSW	5	110668124	missense	probably damaging	1.00
R5388:Ep400	UTSW	5	110701728	missense	unknown
R5401:Ep400	UTSW	5	110683171	missense	unknown
R5431:Ep400	UTSW	5	110676554	missense	unknown
R5461:Ep400	UTSW	5	110676684	nonsense	probably null
R5568:Ep400	UTSW	5	110756205	missense	probably damaging	1.00
R5650:Ep400	UTSW	5	110695952	critical splice donor site	probably null
R5778:Ep400	UTSW	5	110719584	missense	unknown
R5806:Ep400	UTSW	5	110755554	nonsense	probably null
R5814:Ep400	UTSW	5	110695578	splice site	probably null
R5830:Ep400	UTSW	5	110683996	missense	unknown
R5882:Ep400	UTSW	5	110755587	missense	probably benign	0.00
R5931:Ep400	UTSW	5	110735520	unclassified	probably benign
R5945:Ep400	UTSW	5	110682866	missense	unknown
R5966:Ep400	UTSW	5	110676900	missense	unknown
R5973:Ep400	UTSW	5	110729831	missense	unknown
R5980:Ep400	UTSW	5	110733729	unclassified	probably benign
R6000:Ep400	UTSW	5	110683201	missense	unknown
R6006:Ep400	UTSW	5	110704959	missense	unknown
R6053:Ep400	UTSW	5	110755795	missense	probably benign	0.22
R6145:Ep400	UTSW	5	110756703	missense	possibly damaging	0.95
R6154:Ep400	UTSW	5	110755933	missense	probably damaging	0.97
R6169:Ep400	UTSW	5	110741997	missense	possibly damaging	0.83
R6228:Ep400	UTSW	5	110670942	missense	probably damaging	1.00
R6295:Ep400	UTSW	5	110753809	missense	probably benign	0.00
R6486:Ep400	UTSW	5	110697218	unclassified	probably benign
R6504:Ep400	UTSW	5	110708837	unclassified	probably benign
R6607:Ep400	UTSW	5	110683314	missense	unknown
R6657:Ep400	UTSW	5	110693545	unclassified	probably benign
R6660:Ep400	UTSW	5	110719447	nonsense	probably null
R6741:Ep400	UTSW	5	110676895	missense	unknown
R6933:Ep400	UTSW	5	110665862	missense	probably damaging	1.00
R6937:Ep400	UTSW	5	110711152	unclassified	probably benign
R7069:Ep400	UTSW	5	110668124	missense	probably damaging	1.00
R7103:Ep400	UTSW	5	110733785	missense	unknown
R7156:Ep400	UTSW	5	110685363	missense	unknown
R7272:Ep400	UTSW	5	110755645	nonsense	probably null
R7365:Ep400	UTSW	5	110719614	missense	unknown
R7581:Ep400	UTSW	5	110756025	missense	unknown
R7684:Ep400	UTSW	5	110697352	missense	unknown
R7699:Ep400	UTSW	5	110696032	missense	unknown
R7700:Ep400	UTSW	5	110696032	missense	unknown
R7856:Ep400	UTSW	5	110666584	missense	probably damaging	0.99
R7954:Ep400	UTSW	5	110668733	missense	possibly damaging	0.46
R8098:Ep400	UTSW	5	110693251	missense	unknown
R8108:Ep400	UTSW	5	110687883	missense	unknown
R8260:Ep400	UTSW	5	110755612	nonsense	probably null
R8293:Ep400	UTSW	5	110708892	missense	unknown
R8314:Ep400	UTSW	5	110755753	missense	unknown
R8351:Ep400	UTSW	5	110739334	missense	probably damaging	1.00
R8424:Ep400	UTSW	5	110693278	missense	unknown
R8529:Ep400	UTSW	5	110719236	missense	unknown
R8688:Ep400	UTSW	5	110720819	missense	unknown
R8744:Ep400	UTSW	5	110742059	missense	unknown
R8923:Ep400	UTSW	5	110683998	missense	unknown
R9005:Ep400	UTSW	5	110711093	missense	unknown
R9087:Ep400	UTSW	5	110667564	nonsense	probably null
R9146:Ep400	UTSW	5	110701769	nonsense	probably null
R9383:Ep400	UTSW	5	110685485	missense	unknown
X0012:Ep400	UTSW	5	110673196	small deletion	probably benign
X0021:Ep400	UTSW	5	110682864	missense	unknown
Z1176:Ep400	UTSW	5	110756635	missense	unknown
Z1177:Ep400	UTSW	5	110683364	missense	unknown
Z1177:Ep400	UTSW	5	110733743	missense	unknown
Z1188:Ep400	UTSW	5	110755683	missense	unknown

Predicted Primers

PCR Primer
(F):5'- AATCTTTAGGTAAGAACAGCTGGAG -3'
(R):5'- CACAGAGGCCTAAATTGTCAAC -3'

Sequencing Primer
(F):5'- CTGGAGATTTGAAGACAGAACACTTG -3'
(R):5'- TCCATTAGGCTCTAGAAGAACAG -3'

Posted On

2020-10-20