Incidental Mutation 'R8460:Setd1a'
ID 655220
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
MMRRC Submission 067905-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8460 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 127376561-127399294 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 127383292 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 263 (F263L)
Ref Sequence ENSEMBL: ENSMUSP00000047672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000126761] [ENSMUST00000144406] [ENSMUST00000154987]
AlphaFold E9PYH6
Predicted Effect unknown
Transcript: ENSMUST00000047075
AA Change: F263L
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: F263L

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000047157
AA Change: F263L
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: F263L

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154987
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,400,849 (GRCm39) E45* probably null Het
6030458C11Rik T C 15: 12,818,545 (GRCm39) probably benign Het
Abcb11 T C 2: 69,154,381 (GRCm39) M62V possibly damaging Het
Adgrf5 C A 17: 43,750,699 (GRCm39) probably benign Het
Arhgap23 T A 11: 97,343,197 (GRCm39) V493D probably damaging Het
Atg9b T C 5: 24,591,966 (GRCm39) K678E probably damaging Het
Catsperg2 T C 7: 29,404,744 (GRCm39) D773G possibly damaging Het
Cd180 T C 13: 102,839,354 (GRCm39) L79P probably damaging Het
Celsr2 C T 3: 108,304,093 (GRCm39) S2350N possibly damaging Het
Cep85l C A 10: 53,225,313 (GRCm39) R92L probably benign Het
Cyp21a1 T C 17: 35,021,844 (GRCm39) D241G probably benign Het
Dock2 C A 11: 34,180,825 (GRCm39) probably null Het
Fam163a A G 1: 155,955,712 (GRCm39) Y27H probably damaging Het
Gmnc G A 16: 26,779,204 (GRCm39) L274F probably benign Het
Gpc2 A T 5: 138,274,891 (GRCm39) C283S probably damaging Het
Grm5 A G 7: 87,252,249 (GRCm39) I166M probably damaging Het
Ighv3-1 A T 12: 113,928,056 (GRCm39) L101* probably null Het
Impact C T 18: 13,109,564 (GRCm39) S86L probably benign Het
Kif1b C T 4: 149,272,077 (GRCm39) V1575I possibly damaging Het
Klhl6 A G 16: 19,775,781 (GRCm39) V259A probably damaging Het
Krt81 G T 15: 101,361,493 (GRCm39) A29E probably damaging Het
Ldah A G 12: 8,318,548 (GRCm39) N219S probably benign Het
Map3k12 C T 15: 102,410,032 (GRCm39) R581Q probably damaging Het
Marveld3 T C 8: 110,681,040 (GRCm39) D285G probably benign Het
Mcpt2 A G 14: 56,281,201 (GRCm39) D135G possibly damaging Het
Megf6 T A 4: 154,350,634 (GRCm39) C1048* probably null Het
Megf9 A T 4: 70,374,208 (GRCm39) V276D probably damaging Het
Nfya T C 17: 48,698,974 (GRCm39) H273R possibly damaging Het
Olah T A 2: 3,362,762 (GRCm39) Q21H probably damaging Het
Or10s1 T C 9: 39,986,353 (GRCm39) L254P probably damaging Het
Or51t4 T A 7: 102,598,531 (GRCm39) C286* probably null Het
Or7g21 T C 9: 19,032,988 (GRCm39) S243P probably damaging Het
Or8b47 A T 9: 38,427,926 (GRCm39) probably benign Het
Or8k23 T G 2: 86,186,198 (GRCm39) H176P probably damaging Het
Or9s23 T A 1: 92,501,268 (GRCm39) M125K probably damaging Het
Pcdhgb6 T A 18: 37,877,278 (GRCm39) L662Q possibly damaging Het
Pou4f3 T C 18: 42,529,053 (GRCm39) M332T probably damaging Het
Pramel19 C T 4: 101,798,424 (GRCm39) P132S probably benign Het
Pramel58 T A 5: 94,831,790 (GRCm39) C266S probably benign Het
Prg4 G A 1: 150,331,692 (GRCm39) S327L possibly damaging Het
Rdh5 C T 10: 128,754,136 (GRCm39) R99H probably benign Het
Setd2 A G 9: 110,423,338 (GRCm39) N353S Het
Sh3gl1 T C 17: 56,326,321 (GRCm39) N109S probably benign Het
Sidt1 A T 16: 44,107,705 (GRCm39) Y188* probably null Het
Slc25a13 A T 6: 6,073,513 (GRCm39) N448K probably damaging Het
Slc44a5 G A 3: 153,975,667 (GRCm39) V693M probably benign Het
Smad7 T C 18: 75,503,968 (GRCm39) S206P probably damaging Het
Snx33 T A 9: 56,833,476 (GRCm39) I198F possibly damaging Het
Vps13d A T 4: 144,897,009 (GRCm39) probably benign Het
Vps33b T C 7: 79,937,617 (GRCm39) V455A probably benign Het
Zdbf2 CGCTCCGTGCCCCCCGCGCGCCCCGTGCCTCCCACGCGCCCCGTGCCTCCCGCAGGCTCCGTGCCCCCCGCG CGCTCCGTGCCCCCCGCG 1: 63,348,729 (GRCm39) probably benign Het
Zfp26 A T 9: 20,348,373 (GRCm39) H730Q probably damaging Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127,396,870 (GRCm39) unclassified probably benign
IGL02657:Setd1a APN 7 127,394,997 (GRCm39) unclassified probably benign
IGL02792:Setd1a APN 7 127,390,522 (GRCm39) missense unknown
IGL02876:Setd1a APN 7 127,377,673 (GRCm39) splice site probably benign
IGL02967:Setd1a APN 7 127,384,349 (GRCm39) unclassified probably benign
IGL03090:Setd1a APN 7 127,385,672 (GRCm39) missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127,384,718 (GRCm39) missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127,384,498 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,485 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
FR4589:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
FR4737:Setd1a UTSW 7 127,384,484 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,488 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
R0367:Setd1a UTSW 7 127,387,358 (GRCm39) splice site probably benign
R0411:Setd1a UTSW 7 127,395,223 (GRCm39) unclassified probably benign
R0416:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
R0470:Setd1a UTSW 7 127,384,229 (GRCm39) unclassified probably benign
R0645:Setd1a UTSW 7 127,386,382 (GRCm39) missense probably damaging 0.96
R0667:Setd1a UTSW 7 127,385,765 (GRCm39) missense probably damaging 0.99
R1251:Setd1a UTSW 7 127,396,596 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1660:Setd1a UTSW 7 127,395,841 (GRCm39) unclassified probably benign
R1730:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R1760:Setd1a UTSW 7 127,385,062 (GRCm39) missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R2149:Setd1a UTSW 7 127,385,690 (GRCm39) missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127,384,661 (GRCm39) missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127,398,327 (GRCm39) unclassified probably benign
R2679:Setd1a UTSW 7 127,394,896 (GRCm39) unclassified probably benign
R3428:Setd1a UTSW 7 127,384,493 (GRCm39) unclassified probably benign
R4108:Setd1a UTSW 7 127,398,374 (GRCm39) unclassified probably benign
R4227:Setd1a UTSW 7 127,395,819 (GRCm39) unclassified probably benign
R4438:Setd1a UTSW 7 127,384,903 (GRCm39) missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127,396,502 (GRCm39) unclassified probably benign
R4869:Setd1a UTSW 7 127,396,776 (GRCm39) unclassified probably benign
R4892:Setd1a UTSW 7 127,377,696 (GRCm39) missense probably damaging 0.99
R5152:Setd1a UTSW 7 127,383,197 (GRCm39) missense probably benign
R5502:Setd1a UTSW 7 127,396,420 (GRCm39) critical splice donor site probably null
R5527:Setd1a UTSW 7 127,384,801 (GRCm39) missense probably damaging 0.99
R6189:Setd1a UTSW 7 127,377,455 (GRCm39) splice site probably null
R6250:Setd1a UTSW 7 127,390,471 (GRCm39) missense unknown
R7131:Setd1a UTSW 7 127,395,590 (GRCm39) small deletion probably benign
R7988:Setd1a UTSW 7 127,385,366 (GRCm39) missense probably benign 0.02
R8029:Setd1a UTSW 7 127,385,386 (GRCm39) missense probably benign 0.08
R8079:Setd1a UTSW 7 127,384,225 (GRCm39) missense unknown
R8171:Setd1a UTSW 7 127,390,399 (GRCm39) missense unknown
R8175:Setd1a UTSW 7 127,395,415 (GRCm39) missense unknown
R8286:Setd1a UTSW 7 127,385,356 (GRCm39) missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127,390,669 (GRCm39) missense unknown
R8547:Setd1a UTSW 7 127,395,676 (GRCm39) unclassified probably benign
R8699:Setd1a UTSW 7 127,385,774 (GRCm39) missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127,385,332 (GRCm39) missense possibly damaging 0.86
R8968:Setd1a UTSW 7 127,385,279 (GRCm39) missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127,385,558 (GRCm39) missense possibly damaging 0.91
R9178:Setd1a UTSW 7 127,385,590 (GRCm39) missense possibly damaging 0.93
R9672:Setd1a UTSW 7 127,385,237 (GRCm39) missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127,385,752 (GRCm39) missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF008:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF011:Setd1a UTSW 7 127,384,515 (GRCm39) unclassified probably benign
RF014:Setd1a UTSW 7 127,384,518 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,473 (GRCm39) unclassified probably benign
RF031:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF036:Setd1a UTSW 7 127,384,472 (GRCm39) unclassified probably benign
RF041:Setd1a UTSW 7 127,384,504 (GRCm39) unclassified probably benign
RF052:Setd1a UTSW 7 127,384,529 (GRCm39) unclassified probably benign
RF055:Setd1a UTSW 7 127,384,471 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,500 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,475 (GRCm39) unclassified probably benign
RF058:Setd1a UTSW 7 127,384,490 (GRCm39) unclassified probably benign
Z1176:Setd1a UTSW 7 127,398,266 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CAAAGCTGCAATCTCGGATTGG -3'
(R):5'- TCCTTCTCACAGACACTTGGAG -3'

Sequencing Primer
(F):5'- GGCAGTAGACAGTTTTAAATCGTGCC -3'
(R):5'- ACAGACACTTGGAGCTTGTTC -3'
Posted On 2020-10-20