Incidental Mutation 'R8460:Marveld3'
ID655221
Institutional Source Beutler Lab
Gene Symbol Marveld3
Ensembl Gene ENSMUSG00000001672
Gene NameMARVEL (membrane-associating) domain containing 3
Synonyms1810006A16Rik, MARVD3, Mrvldc3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8460 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location109947914-109962203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109954408 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 285 (D285G)
Ref Sequence ENSEMBL: ENSMUSP00000052309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001722] [ENSMUST00000051430]
Predicted Effect probably benign
Transcript: ENSMUST00000001722
SMART Domains Protein: ENSMUSP00000001722
Gene: ENSMUSG00000001672

DomainStartEndE-ValueType
low complexity region 7 33 N/A INTRINSIC
low complexity region 43 74 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 239 261 N/A INTRINSIC
transmembrane domain 274 296 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051430
AA Change: D285G

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000052309
Gene: ENSMUSG00000001672
AA Change: D285G

DomainStartEndE-ValueType
low complexity region 7 33 N/A INTRINSIC
low complexity region 43 74 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
Pfam:MARVEL 168 355 3.2e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
Abcb11 T C 2: 69,324,037 M62V possibly damaging Het
Arhgap23 T A 11: 97,452,371 V493D probably damaging Het
Atg9b T C 5: 24,386,968 K678E probably damaging Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Cd180 T C 13: 102,702,846 L79P probably damaging Het
Celsr2 C T 3: 108,396,777 S2350N possibly damaging Het
Cep85l C A 10: 53,349,217 R92L probably benign Het
Cyp21a1 T C 17: 34,802,870 D241G probably benign Het
Dock2 C A 11: 34,230,825 probably null Het
Fam163a A G 1: 156,079,966 Y27H probably damaging Het
Gm12794 C T 4: 101,941,227 P132S probably benign Het
Gm6205 T A 5: 94,683,931 C266S probably benign Het
Gmnc G A 16: 26,960,454 L274F probably benign Het
Gpc2 A T 5: 138,276,629 C283S probably damaging Het
Grm5 A G 7: 87,603,041 I166M probably damaging Het
Ighv3-1 A T 12: 113,964,436 L101* probably null Het
Impact C T 18: 12,976,507 S86L probably benign Het
Kif1b C T 4: 149,187,620 V1575I possibly damaging Het
Klhl6 A G 16: 19,957,031 V259A probably damaging Het
Krt81 G T 15: 101,463,612 A29E probably damaging Het
Ldah A G 12: 8,268,548 N219S probably benign Het
Map3k12 C T 15: 102,501,597 R581Q probably damaging Het
Mcpt2 A G 14: 56,043,744 D135G possibly damaging Het
Megf6 T A 4: 154,266,177 C1048* probably null Het
Megf9 A T 4: 70,455,971 V276D probably damaging Het
Nfya T C 17: 48,391,946 H273R possibly damaging Het
Olah T A 2: 3,361,725 Q21H probably damaging Het
Olfr1056 T G 2: 86,355,854 H176P probably damaging Het
Olfr1413 T A 1: 92,573,546 M125K probably damaging Het
Olfr574 T A 7: 102,949,324 C286* probably null Het
Olfr836 T C 9: 19,121,692 S243P probably damaging Het
Olfr982 T C 9: 40,075,057 L254P probably damaging Het
Pcdhgb6 T A 18: 37,744,225 L662Q possibly damaging Het
Pou4f3 T C 18: 42,395,988 M332T probably damaging Het
Prg4 G A 1: 150,455,941 S327L possibly damaging Het
Rdh5 C T 10: 128,918,267 R99H probably benign Het
Setd1a T C 7: 127,784,120 F263L unknown Het
Setd2 A G 9: 110,594,270 N353S Het
Sh3gl1 T C 17: 56,019,321 N109S probably benign Het
Sidt1 A T 16: 44,287,342 Y188* probably null Het
Slc25a13 A T 6: 6,073,513 N448K probably damaging Het
Slc44a5 G A 3: 154,270,030 V693M probably benign Het
Smad7 T C 18: 75,370,897 S206P probably damaging Het
Snx33 T A 9: 56,926,192 I198F possibly damaging Het
Vps33b T C 7: 80,287,869 V455A probably benign Het
Zdbf2 CGCTCCGTGCCCCCCGCGCGCCCCGTGCCTCCCACGCGCCCCGTGCCTCCCGCAGGCTCCGTGCCCCCCGCG CGCTCCGTGCCCCCCGCG 1: 63,309,570 probably benign Het
Zfp26 A T 9: 20,437,077 H730Q probably damaging Het
Other mutations in Marveld3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Marveld3 APN 8 109961964 missense possibly damaging 0.81
IGL01341:Marveld3 APN 8 109948417 missense possibly damaging 0.94
IGL01415:Marveld3 APN 8 109962073 missense possibly damaging 0.92
IGL01759:Marveld3 APN 8 109948087 missense possibly damaging 0.90
IGL02012:Marveld3 APN 8 109948132 missense probably damaging 0.99
R0732:Marveld3 UTSW 8 109948483 missense probably damaging 0.99
R1500:Marveld3 UTSW 8 109948542 splice site probably null
R1955:Marveld3 UTSW 8 109959748 missense probably benign 0.08
R2146:Marveld3 UTSW 8 109959802 missense probably benign 0.00
R2172:Marveld3 UTSW 8 109961846 missense probably benign 0.22
R4843:Marveld3 UTSW 8 109962070 missense possibly damaging 0.66
R4925:Marveld3 UTSW 8 109948311 missense probably benign 0.00
R5542:Marveld3 UTSW 8 109948617 missense probably benign 0.03
R6003:Marveld3 UTSW 8 109954328 missense probably damaging 1.00
R6733:Marveld3 UTSW 8 109962049 missense possibly damaging 0.90
R6786:Marveld3 UTSW 8 109948100 missense probably benign 0.13
R7156:Marveld3 UTSW 8 109948188 missense probably damaging 1.00
R7194:Marveld3 UTSW 8 109959845 splice site probably null
R7429:Marveld3 UTSW 8 109948468 missense possibly damaging 0.77
R7430:Marveld3 UTSW 8 109948468 missense possibly damaging 0.77
R7810:Marveld3 UTSW 8 109954634 missense probably damaging 0.99
R8421:Marveld3 UTSW 8 109948647 missense probably benign 0.07
R8478:Marveld3 UTSW 8 109961968 missense probably damaging 1.00
Z1088:Marveld3 UTSW 8 109948063 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATGGCTGCAAAGACTCCTGC -3'
(R):5'- TACTACTACCAGTATGGAGGGG -3'

Sequencing Primer
(F):5'- GCAAAGACTCCTGCTCCTATG -3'
(R):5'- TACTACCAGTATGGAGGGGCTTATAG -3'
Posted On2020-10-20