Incidental Mutation 'R8460:Ighv3-1'
ID 655232
Institutional Source Beutler Lab
Gene Symbol Ighv3-1
Ensembl Gene ENSMUSG00000093838
Gene Name immunoglobulin heavy variable 3-1
Synonyms Gm16610
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock # R8460 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 113964388-113964818 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 113964436 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 101 (L101*)
Ref Sequence ENSEMBL: ENSMUSP00000100259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103478]
AlphaFold A0A075B5S6
Predicted Effect probably null
Transcript: ENSMUST00000103478
AA Change: L101*
SMART Domains Protein: ENSMUSP00000100259
Gene: ENSMUSG00000093838
AA Change: L101*

DomainStartEndE-ValueType
IGv 35 116 9.51e-28 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
6030458C11Rik T C 15: 12,818,459 probably benign Het
Abcb11 T C 2: 69,324,037 M62V possibly damaging Het
Adgrf5 C A 17: 43,439,808 probably benign Het
Arhgap23 T A 11: 97,452,371 V493D probably damaging Het
Atg9b T C 5: 24,386,968 K678E probably damaging Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Cd180 T C 13: 102,702,846 L79P probably damaging Het
Celsr2 C T 3: 108,396,777 S2350N possibly damaging Het
Cep85l C A 10: 53,349,217 R92L probably benign Het
Cyp21a1 T C 17: 34,802,870 D241G probably benign Het
Dock2 C A 11: 34,230,825 probably null Het
Fam163a A G 1: 156,079,966 Y27H probably damaging Het
Gm12794 C T 4: 101,941,227 P132S probably benign Het
Gm6205 T A 5: 94,683,931 C266S probably benign Het
Gmnc G A 16: 26,960,454 L274F probably benign Het
Gpc2 A T 5: 138,276,629 C283S probably damaging Het
Grm5 A G 7: 87,603,041 I166M probably damaging Het
Impact C T 18: 12,976,507 S86L probably benign Het
Kif1b C T 4: 149,187,620 V1575I possibly damaging Het
Klhl6 A G 16: 19,957,031 V259A probably damaging Het
Krt81 G T 15: 101,463,612 A29E probably damaging Het
Ldah A G 12: 8,268,548 N219S probably benign Het
Map3k12 C T 15: 102,501,597 R581Q probably damaging Het
Marveld3 T C 8: 109,954,408 D285G probably benign Het
Mcpt2 A G 14: 56,043,744 D135G possibly damaging Het
Megf6 T A 4: 154,266,177 C1048* probably null Het
Megf9 A T 4: 70,455,971 V276D probably damaging Het
Nfya T C 17: 48,391,946 H273R possibly damaging Het
Olah T A 2: 3,361,725 Q21H probably damaging Het
Olfr1056 T G 2: 86,355,854 H176P probably damaging Het
Olfr1413 T A 1: 92,573,546 M125K probably damaging Het
Olfr574 T A 7: 102,949,324 C286* probably null Het
Olfr836 T C 9: 19,121,692 S243P probably damaging Het
Olfr911-ps1 A T 9: 38,516,630 probably benign Het
Olfr982 T C 9: 40,075,057 L254P probably damaging Het
Pcdhgb6 T A 18: 37,744,225 L662Q possibly damaging Het
Pou4f3 T C 18: 42,395,988 M332T probably damaging Het
Prg4 G A 1: 150,455,941 S327L possibly damaging Het
Rdh5 C T 10: 128,918,267 R99H probably benign Het
Setd1a T C 7: 127,784,120 F263L unknown Het
Setd2 A G 9: 110,594,270 N353S Het
Sh3gl1 T C 17: 56,019,321 N109S probably benign Het
Sidt1 A T 16: 44,287,342 Y188* probably null Het
Slc25a13 A T 6: 6,073,513 N448K probably damaging Het
Slc44a5 G A 3: 154,270,030 V693M probably benign Het
Smad7 T C 18: 75,370,897 S206P probably damaging Het
Snx33 T A 9: 56,926,192 I198F possibly damaging Het
Vps13d A T 4: 145,170,439 probably benign Het
Vps33b T C 7: 80,287,869 V455A probably benign Het
Zdbf2 CGCTCCGTGCCCCCCGCGCGCCCCGTGCCTCCCACGCGCCCCGTGCCTCCCGCAGGCTCCGTGCCCCCCGCG CGCTCCGTGCCCCCCGCG 1: 63,309,570 probably benign Het
Zfp26 A T 9: 20,437,077 H730Q probably damaging Het
Other mutations in Ighv3-1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4458001:Ighv3-1 UTSW 12 113964604 missense probably benign 0.03
R4077:Ighv3-1 UTSW 12 113964487 missense probably damaging 0.97
R5438:Ighv3-1 UTSW 12 113964469 missense probably benign
R5563:Ighv3-1 UTSW 12 113964586 missense probably benign 0.12
R7748:Ighv3-1 UTSW 12 113964650 missense probably damaging 0.98
R9117:Ighv3-1 UTSW 12 113964469 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCAGAGTTTTGGGCAAC -3'
(R):5'- CCTGGCATGGTGAAACCTTCTC -3'

Sequencing Primer
(F):5'- GCTCTGCAAGGAGGTTTT -3'
(R):5'- GCATGGTGAAACCTTCTCAGTCAC -3'
Posted On 2020-10-20