Incidental Mutation 'R8461:Ccdc187'
ID 655255
Institutional Source Beutler Lab
Gene Symbol Ccdc187
Ensembl Gene ENSMUSG00000048038
Gene Name coiled-coil domain containing 187
Synonyms 4932418E24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R8461 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 26243469-26294557 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26293802 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 62 (L62P)
Ref Sequence ENSEMBL: ENSMUSP00000054283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057224] [ENSMUST00000217256] [ENSMUST00000227200]
AlphaFold Q8C5V8
Predicted Effect probably damaging
Transcript: ENSMUST00000057224
AA Change: L62P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054283
Gene: ENSMUSG00000048038
AA Change: L62P

DomainStartEndE-ValueType
low complexity region 116 132 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
coiled coil region 717 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217256
AA Change: L62P
Predicted Effect unknown
Transcript: ENSMUST00000227200
AA Change: L62P
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4921539E11Rik T C 4: 103,255,515 D132G probably benign Het
Abca16 T C 7: 120,436,695 F334L possibly damaging Het
Ache T C 5: 137,290,320 F96S probably damaging Het
Actg1 T C 11: 120,348,184 T27A unknown Het
Ankrd27 T C 7: 35,627,486 L752P probably damaging Het
Atp1a1 T A 3: 101,589,089 T417S probably benign Het
Atp6v0a1 T G 11: 101,044,574 L653R possibly damaging Het
Aurkb T C 11: 69,050,901 V293A probably damaging Het
C2cd5 A T 6: 143,035,076 D654E probably damaging Het
Cacna1s T C 1: 136,073,702 V297A possibly damaging Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Cdh2 A G 18: 16,650,465 V69A probably benign Het
D430041D05Rik A G 2: 104,167,935 V1156A possibly damaging Het
Defb37 G A 8: 18,986,370 H45Y unknown Het
Dgke T C 11: 89,048,993 M367V possibly damaging Het
Dnah1 T C 14: 31,305,958 K640R probably benign Het
Gm5478 A T 15: 101,646,217 L148Q probably damaging Het
Hhla1 A T 15: 65,923,874 S494R probably benign Het
Kcne4 G A 1: 78,817,716 S27N probably benign Het
Klhdc7b A T 15: 89,387,621 H244L probably damaging Het
Lrrc40 T C 3: 158,058,734 S429P possibly damaging Het
Map3k21 A T 8: 125,944,622 D883V probably benign Het
Med4 T C 14: 73,518,028 S259P unknown Het
Mrm3 T C 11: 76,244,332 I123T probably damaging Het
Mrpl1 T A 5: 96,213,787 V11D probably damaging Het
Myl1 G A 1: 66,944,835 P24L unknown Het
Necap2 T C 4: 141,070,220 K168R probably damaging Het
Nnt A G 13: 119,368,502 S559P unknown Het
Nox4 T C 7: 87,317,271 F197L probably damaging Het
Nup93 T C 8: 94,281,335 probably null Het
Nxph2 T C 2: 23,321,517 V10A unknown Het
Olfr1 T A 11: 73,395,156 I289F probably damaging Het
Olfr1085 G A 2: 86,657,546 T304I probably benign Het
Olfr251 T A 9: 38,378,481 V194D probably damaging Het
P2ry2 G T 7: 100,998,688 R137S possibly damaging Het
Plxnb3 T C X: 73,759,497 Y324H probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Ppme1 T C 7: 100,371,805 S7G probably benign Het
Rabep1 T A 11: 70,884,855 M85K possibly damaging Het
Ranbp2 T C 10: 58,476,394 Y979H probably damaging Het
Rapgef5 T C 12: 117,714,109 S360P probably benign Het
Rbm33 T A 5: 28,387,972 H623Q probably damaging Het
Rev1 G T 1: 38,083,787 T450K possibly damaging Het
Sec23ip T A 7: 128,772,202 L716Q probably benign Het
Sp2 T C 11: 96,955,913 T535A possibly damaging Het
Syne1 A G 10: 5,061,463 S61P probably benign Het
Tcf4 T C 18: 69,465,430 V72A probably benign Het
Tmem131 G A 1: 36,794,821 S1726F probably damaging Het
Trim13 T C 14: 61,605,472 Y313H probably benign Het
Ttn A G 2: 76,781,093 V17365A possibly damaging Het
Uap1l1 G A 2: 25,365,410 A69V probably benign Het
Upp2 A G 2: 58,780,056 D258G probably benign Het
Vmn1r44 A T 6: 89,893,719 H149L possibly damaging Het
Zbtb49 T C 5: 38,201,109 D600G probably benign Het
Zfp869 G T 8: 69,707,655 H89Q probably benign Het
Other mutations in Ccdc187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Ccdc187 APN 2 26280948 missense probably benign
IGL02989:Ccdc187 APN 2 26276431 missense possibly damaging 0.92
IGL03017:Ccdc187 APN 2 26280966 missense probably benign
IGL03059:Ccdc187 APN 2 26294241 missense probably null 1.00
IGL03117:Ccdc187 APN 2 26287968 missense possibly damaging 0.95
R0026:Ccdc187 UTSW 2 26281353 missense probably benign 0.00
R0144:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R1078:Ccdc187 UTSW 2 26294377 missense probably damaging 0.98
R1226:Ccdc187 UTSW 2 26276121 missense probably damaging 0.99
R1624:Ccdc187 UTSW 2 26281075 missense probably benign
R1733:Ccdc187 UTSW 2 26293658 missense possibly damaging 0.93
R1851:Ccdc187 UTSW 2 26276068 missense probably benign 0.17
R2304:Ccdc187 UTSW 2 26281017 missense possibly damaging 0.94
R4278:Ccdc187 UTSW 2 26282227 intron probably benign
R4344:Ccdc187 UTSW 2 26280669 missense probably damaging 1.00
R5151:Ccdc187 UTSW 2 26293439 missense probably damaging 1.00
R5416:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5537:Ccdc187 UTSW 2 26276225 missense probably benign 0.32
R5761:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5762:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5865:Ccdc187 UTSW 2 26293368 missense probably benign 0.00
R5925:Ccdc187 UTSW 2 26293581 missense probably benign
R6261:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R6803:Ccdc187 UTSW 2 26289779 missense probably benign 0.02
R6888:Ccdc187 UTSW 2 26289734 missense probably damaging 0.98
R6958:Ccdc187 UTSW 2 26289719 missense probably benign
R7006:Ccdc187 UTSW 2 26281090 missense probably benign 0.05
R7358:Ccdc187 UTSW 2 26255995 missense probably damaging 0.97
R7818:Ccdc187 UTSW 2 26276174 missense possibly damaging 0.61
R8048:Ccdc187 UTSW 2 26293514 missense possibly damaging 0.53
R8327:Ccdc187 UTSW 2 26280618 missense probably benign 0.01
R8353:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8425:Ccdc187 UTSW 2 26281536 missense probably damaging 0.99
R8453:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8534:Ccdc187 UTSW 2 26275565 missense possibly damaging 0.61
R8694:Ccdc187 UTSW 2 26275493 missense probably benign 0.02
R8745:Ccdc187 UTSW 2 26280514 missense probably damaging 0.99
R8958:Ccdc187 UTSW 2 26275565 missense probably benign 0.02
R8972:Ccdc187 UTSW 2 26281067 missense probably benign
R9214:Ccdc187 UTSW 2 26293397 missense probably benign 0.19
Z1176:Ccdc187 UTSW 2 26281507 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CATGAGAAAGTGTGCATGATTCATG -3'
(R):5'- GTCAGGAGATGTCCATGTGG -3'

Sequencing Primer
(F):5'- AGACATTCTGCCGGATGAC -3'
(R):5'- GGTGGAGGAATTTTCTGGTTCC -3'
Posted On 2020-10-20