Incidental Mutation 'R8461:Upp2'
ID655257
Institutional Source Beutler Lab
Gene Symbol Upp2
Ensembl Gene ENSMUSG00000026839
Gene Nameuridine phosphorylase 2
SynonymsUDRPASE2, UP2, UPASE2, 1700124F02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R8461 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location58567298-58792971 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58780056 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 258 (D258G)
Ref Sequence ENSEMBL: ENSMUSP00000060437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059102] [ENSMUST00000071543] [ENSMUST00000102755] [ENSMUST00000229923] [ENSMUST00000230627]
Predicted Effect probably benign
Transcript: ENSMUST00000059102
AA Change: D258G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000060437
Gene: ENSMUSG00000026839
AA Change: D258G

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 78 328 6.4e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071543
AA Change: D278G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000071474
Gene: ENSMUSG00000026839
AA Change: D278G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:PNP_UDP_1 98 316 7.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102755
AA Change: D240G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099816
Gene: ENSMUSG00000026839
AA Change: D240G

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 60 310 4.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229923
AA Change: D240G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000230627
AA Change: D206G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4921539E11Rik T C 4: 103,255,515 D132G probably benign Het
Abca16 T C 7: 120,436,695 F334L possibly damaging Het
Ache T C 5: 137,290,320 F96S probably damaging Het
Actg1 T C 11: 120,348,184 T27A unknown Het
Ankrd27 T C 7: 35,627,486 L752P probably damaging Het
Atp1a1 T A 3: 101,589,089 T417S probably benign Het
Atp6v0a1 T G 11: 101,044,574 L653R possibly damaging Het
Aurkb T C 11: 69,050,901 V293A probably damaging Het
C2cd5 A T 6: 143,035,076 D654E probably damaging Het
Cacna1s T C 1: 136,073,702 V297A possibly damaging Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccdc187 A G 2: 26,293,802 L62P probably damaging Het
Cdh2 A G 18: 16,650,465 V69A probably benign Het
D430041D05Rik A G 2: 104,167,935 V1156A possibly damaging Het
Defb37 G A 8: 18,986,370 H45Y unknown Het
Dgke T C 11: 89,048,993 M367V possibly damaging Het
Dnah1 T C 14: 31,305,958 K640R probably benign Het
Gm5478 A T 15: 101,646,217 L148Q probably damaging Het
Hhla1 A T 15: 65,923,874 S494R probably benign Het
Kcne4 G A 1: 78,817,716 S27N probably benign Het
Klhdc7b A T 15: 89,387,621 H244L probably damaging Het
Lrrc40 T C 3: 158,058,734 S429P possibly damaging Het
Map3k21 A T 8: 125,944,622 D883V probably benign Het
Med4 T C 14: 73,518,028 S259P unknown Het
Mrm3 T C 11: 76,244,332 I123T probably damaging Het
Mrpl1 T A 5: 96,213,787 V11D probably damaging Het
Myl1 G A 1: 66,944,835 P24L unknown Het
Necap2 T C 4: 141,070,220 K168R probably damaging Het
Nnt A G 13: 119,368,502 S559P unknown Het
Nox4 T C 7: 87,317,271 F197L probably damaging Het
Nup93 T C 8: 94,281,335 probably null Het
Nxph2 T C 2: 23,321,517 V10A unknown Het
Olfr1 T A 11: 73,395,156 I289F probably damaging Het
Olfr1085 G A 2: 86,657,546 T304I probably benign Het
Olfr251 T A 9: 38,378,481 V194D probably damaging Het
P2ry2 G T 7: 100,998,688 R137S possibly damaging Het
Plxnb3 T C X: 73,759,497 Y324H probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Ppme1 T C 7: 100,371,805 S7G probably benign Het
Rabep1 T A 11: 70,884,855 M85K possibly damaging Het
Ranbp2 T C 10: 58,476,394 Y979H probably damaging Het
Rapgef5 T C 12: 117,714,109 S360P probably benign Het
Rbm33 T A 5: 28,387,972 H623Q probably damaging Het
Rev1 G T 1: 38,083,787 T450K possibly damaging Het
Sec23ip T A 7: 128,772,202 L716Q probably benign Het
Sp2 T C 11: 96,955,913 T535A possibly damaging Het
Syne1 A G 10: 5,061,463 S61P probably benign Het
Tcf4 T C 18: 69,465,430 V72A probably benign Het
Tmem131 G A 1: 36,794,821 S1726F probably damaging Het
Trim13 T C 14: 61,605,472 Y313H probably benign Het
Ttn A G 2: 76,781,093 V17365A possibly damaging Het
Uap1l1 G A 2: 25,365,410 A69V probably benign Het
Vmn1r44 A T 6: 89,893,719 H149L possibly damaging Het
Zbtb49 T C 5: 38,201,109 D600G probably benign Het
Zfp869 G T 8: 69,707,655 H89Q probably benign Het
Other mutations in Upp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Upp2 APN 2 58790064 missense probably benign 0.43
IGL01716:Upp2 APN 2 58790046 missense probably damaging 0.99
IGL02069:Upp2 APN 2 58771417 splice site probably benign
IGL02349:Upp2 APN 2 58777886 missense probably benign 0.03
IGL03072:Upp2 APN 2 58755423 critical splice donor site probably null
R0815:Upp2 UTSW 2 58771556 missense probably benign 0.00
R1164:Upp2 UTSW 2 58763704 missense probably damaging 1.00
R1400:Upp2 UTSW 2 58790106 missense probably damaging 1.00
R1553:Upp2 UTSW 2 58790140 missense probably damaging 1.00
R1581:Upp2 UTSW 2 58774165 missense possibly damaging 0.93
R1674:Upp2 UTSW 2 58790064 missense probably benign 0.43
R1702:Upp2 UTSW 2 58771550 missense possibly damaging 0.86
R1902:Upp2 UTSW 2 58771452 missense probably damaging 1.00
R2351:Upp2 UTSW 2 58763662 splice site probably null
R3011:Upp2 UTSW 2 58790095 missense probably damaging 0.97
R3622:Upp2 UTSW 2 58790116 missense possibly damaging 0.83
R3623:Upp2 UTSW 2 58790116 missense possibly damaging 0.83
R3731:Upp2 UTSW 2 58755367 missense probably benign 0.02
R4257:Upp2 UTSW 2 58780094 missense probably damaging 1.00
R4296:Upp2 UTSW 2 58778009 missense probably damaging 1.00
R4768:Upp2 UTSW 2 58777895 missense probably damaging 0.99
R5116:Upp2 UTSW 2 58771542 missense probably damaging 1.00
R5638:Upp2 UTSW 2 58790095 missense probably damaging 0.97
R7100:Upp2 UTSW 2 58791805 missense probably benign
R7421:Upp2 UTSW 2 58771574 missense possibly damaging 0.49
R7727:Upp2 UTSW 2 58774148 missense possibly damaging 0.95
R7840:Upp2 UTSW 2 58774115 critical splice acceptor site probably null
R8033:Upp2 UTSW 2 58780059 missense probably damaging 1.00
R8359:Upp2 UTSW 2 58777943 missense probably benign 0.05
R8510:Upp2 UTSW 2 58780106 missense probably damaging 1.00
Z1177:Upp2 UTSW 2 58780062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGAGTCCACAGCCAGGTC -3'
(R):5'- CAATTTTAAGGCATGCGTTCAG -3'

Sequencing Primer
(F):5'- AGCCAGGTCCCCAGAAGAG -3'
(R):5'- ATAAAATGTGTTGGGGCCCCC -3'
Posted On2020-10-20