Incidental Mutation 'R8461:Abca16'
ID655276
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene NameATP-binding cassette, sub-family A (ABC1), member 16
Synonyms
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001278943.1, NM_001278944.1; MGI:2388711

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8461 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location120409647-120544813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120436695 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 334 (F334L)
Ref Sequence ENSEMBL: ENSMUSP00000112736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
AlphaFold E9PWJ7
Predicted Effect probably damaging
Transcript: ENSMUST00000056042
AA Change: F334L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: F334L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120490
AA Change: F334L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: F334L

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4921539E11Rik T C 4: 103,255,515 D132G probably benign Het
Ache T C 5: 137,290,320 F96S probably damaging Het
Actg1 T C 11: 120,348,184 T27A unknown Het
Ankrd27 T C 7: 35,627,486 L752P probably damaging Het
Atp1a1 T A 3: 101,589,089 T417S probably benign Het
Atp6v0a1 T G 11: 101,044,574 L653R possibly damaging Het
Aurkb T C 11: 69,050,901 V293A probably damaging Het
C2cd5 A T 6: 143,035,076 D654E probably damaging Het
Cacna1s T C 1: 136,073,702 V297A possibly damaging Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccdc187 A G 2: 26,293,802 L62P probably damaging Het
Cdh2 A G 18: 16,650,465 V69A probably benign Het
D430041D05Rik A G 2: 104,167,935 V1156A possibly damaging Het
Defb37 G A 8: 18,986,370 H45Y unknown Het
Dgke T C 11: 89,048,993 M367V possibly damaging Het
Dnah1 T C 14: 31,305,958 K640R probably benign Het
Gm5478 A T 15: 101,646,217 L148Q probably damaging Het
Hhla1 A T 15: 65,923,874 S494R probably benign Het
Kcne4 G A 1: 78,817,716 S27N probably benign Het
Klhdc7b A T 15: 89,387,621 H244L probably damaging Het
Lrrc40 T C 3: 158,058,734 S429P possibly damaging Het
Map3k21 A T 8: 125,944,622 D883V probably benign Het
Med4 T C 14: 73,518,028 S259P unknown Het
Mrm3 T C 11: 76,244,332 I123T probably damaging Het
Mrpl1 T A 5: 96,213,787 V11D probably damaging Het
Myl1 G A 1: 66,944,835 P24L unknown Het
Necap2 T C 4: 141,070,220 K168R probably damaging Het
Nnt A G 13: 119,368,502 S559P unknown Het
Nox4 T C 7: 87,317,271 F197L probably damaging Het
Nup93 T C 8: 94,281,335 probably null Het
Nxph2 T C 2: 23,321,517 V10A unknown Het
Olfr1 T A 11: 73,395,156 I289F probably damaging Het
Olfr1085 G A 2: 86,657,546 T304I probably benign Het
Olfr251 T A 9: 38,378,481 V194D probably damaging Het
P2ry2 G T 7: 100,998,688 R137S possibly damaging Het
Plxnb3 T C X: 73,759,497 Y324H probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Ppme1 T C 7: 100,371,805 S7G probably benign Het
Rabep1 T A 11: 70,884,855 M85K possibly damaging Het
Ranbp2 T C 10: 58,476,394 Y979H probably damaging Het
Rapgef5 T C 12: 117,714,109 S360P probably benign Het
Rbm33 T A 5: 28,387,972 H623Q probably damaging Het
Rev1 G T 1: 38,083,787 T450K possibly damaging Het
Sec23ip T A 7: 128,772,202 L716Q probably benign Het
Sp2 T C 11: 96,955,913 T535A possibly damaging Het
Syne1 A G 10: 5,061,463 S61P probably benign Het
Tcf4 T C 18: 69,465,430 V72A probably benign Het
Tmem131 G A 1: 36,794,821 S1726F probably damaging Het
Trim13 T C 14: 61,605,472 Y313H probably benign Het
Ttn A G 2: 76,781,093 V17365A possibly damaging Het
Uap1l1 G A 2: 25,365,410 A69V probably benign Het
Upp2 A G 2: 58,780,056 D258G probably benign Het
Vmn1r44 A T 6: 89,893,719 H149L possibly damaging Het
Zbtb49 T C 5: 38,201,109 D600G probably benign Het
Zfp869 G T 8: 69,707,655 H89Q probably benign Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120423759 missense probably benign 0.08
IGL00590:Abca16 APN 7 120423815 missense probably damaging 1.00
IGL01320:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01322:Abca16 APN 7 120439199 missense probably damaging 1.00
IGL01613:Abca16 APN 7 120541277 missense probably benign 0.03
IGL01774:Abca16 APN 7 120477835 missense probably damaging 1.00
IGL01774:Abca16 APN 7 120421801 splice site probably benign
IGL01797:Abca16 APN 7 120514537 missense probably benign 0.15
IGL02406:Abca16 APN 7 120540602 missense probably damaging 1.00
IGL02437:Abca16 APN 7 120533729 missense probably benign 0.00
IGL02541:Abca16 APN 7 120514658 missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120433455 missense probably benign 0.05
IGL02578:Abca16 APN 7 120423956 critical splice donor site probably null
IGL03156:Abca16 APN 7 120423851 missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120527818 missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120540128 missense probably benign 0.31
R0024:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0026:Abca16 UTSW 7 120477923 splice site probably benign
R0123:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0134:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0225:Abca16 UTSW 7 120540155 missense probably damaging 1.00
R0346:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R0355:Abca16 UTSW 7 120423798 missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120544716 missense probably benign 0.01
R0525:Abca16 UTSW 7 120465810 nonsense probably null
R0617:Abca16 UTSW 7 120433611 splice site probably benign
R0625:Abca16 UTSW 7 120435893 missense probably damaging 1.00
R0835:Abca16 UTSW 7 120465784 missense probably benign 0.42
R1445:Abca16 UTSW 7 120520033 missense probably benign 0.41
R1535:Abca16 UTSW 7 120540705 missense probably benign 0.30
R1567:Abca16 UTSW 7 120431129 missense probably benign 0.08
R1694:Abca16 UTSW 7 120520084 missense probably damaging 1.00
R1860:Abca16 UTSW 7 120534763 missense probably benign 0.02
R1876:Abca16 UTSW 7 120433385 missense probably damaging 1.00
R1913:Abca16 UTSW 7 120541240 missense probably benign 0.04
R1940:Abca16 UTSW 7 120433609 splice site probably benign
R2042:Abca16 UTSW 7 120544718 missense probably benign
R2115:Abca16 UTSW 7 120540645 missense probably damaging 1.00
R2122:Abca16 UTSW 7 120519961 missense probably damaging 1.00
R2265:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2267:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2269:Abca16 UTSW 7 120431160 missense probably benign 0.03
R2993:Abca16 UTSW 7 120535161 missense probably damaging 1.00
R3055:Abca16 UTSW 7 120435851 missense probably benign 0.05
R3956:Abca16 UTSW 7 120527752 missense probably damaging 0.96
R4114:Abca16 UTSW 7 120527067 missense probably benign 0.06
R4441:Abca16 UTSW 7 120527801 missense probably benign 0.04
R4601:Abca16 UTSW 7 120436697 missense probably damaging 0.98
R4706:Abca16 UTSW 7 120465765 missense probably damaging 1.00
R4807:Abca16 UTSW 7 120540609 missense probably damaging 1.00
R4824:Abca16 UTSW 7 120475479 missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120527086 missense probably damaging 0.98
R5152:Abca16 UTSW 7 120540623 missense probably benign 0.02
R5257:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5258:Abca16 UTSW 7 120436769 critical splice donor site probably null
R5330:Abca16 UTSW 7 120503377 missense probably benign 0.15
R5388:Abca16 UTSW 7 120540746 critical splice donor site probably null
R5590:Abca16 UTSW 7 120544772 missense probably damaging 0.98
R5810:Abca16 UTSW 7 120435932 missense probably damaging 1.00
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6030:Abca16 UTSW 7 120533798 missense probably benign
R6161:Abca16 UTSW 7 120540711 missense probably damaging 1.00
R6313:Abca16 UTSW 7 120527121 missense probably damaging 1.00
R6485:Abca16 UTSW 7 120427167 nonsense probably null
R6527:Abca16 UTSW 7 120477772 missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120527053 missense probably damaging 1.00
R6885:Abca16 UTSW 7 120520109 missense probably benign 0.07
R6899:Abca16 UTSW 7 120527041 missense probably damaging 1.00
R6941:Abca16 UTSW 7 120541147 missense probably damaging 1.00
R6990:Abca16 UTSW 7 120527727 missense probably benign 0.00
R7059:Abca16 UTSW 7 120421748 missense probably benign 0.00
R7144:Abca16 UTSW 7 120433573 missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120527751 missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120427186 missense probably damaging 1.00
R7308:Abca16 UTSW 7 120423770 missense probably benign 0.01
R7449:Abca16 UTSW 7 120435908 missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120519988 missense probably benign 0.11
R7617:Abca16 UTSW 7 120503471 nonsense probably null
R7646:Abca16 UTSW 7 120514714 missense probably benign 0.04
R7750:Abca16 UTSW 7 120514705 missense probably benign 0.09
R7763:Abca16 UTSW 7 120514602 missense probably damaging 1.00
R7840:Abca16 UTSW 7 120475466 missense probably benign 0.00
R7946:Abca16 UTSW 7 120527175 missense probably benign 0.01
R8018:Abca16 UTSW 7 120533643 missense probably benign 0.04
R8170:Abca16 UTSW 7 120465782 missense probably damaging 1.00
R8413:Abca16 UTSW 7 120423900 missense probably benign 0.06
R8858:Abca16 UTSW 7 120453104 missense probably benign
R8881:Abca16 UTSW 7 120475571 missense probably benign 0.18
RF020:Abca16 UTSW 7 120533657 missense possibly damaging 0.90
X0066:Abca16 UTSW 7 120503386 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCAGCAAGACTTTAACTTCCTG -3'
(R):5'- GAATTTACTGGTCTAGAAACGAGC -3'

Sequencing Primer
(F):5'- AAGACTTTAACTTCCTGTCTTTGGG -3'
(R):5'- TTACTGGTCTAGAAACGAGCAAAAAG -3'
Posted On2020-10-20