Incidental Mutation 'R8461:Trim13'
ID655296
Institutional Source Beutler Lab
Gene Symbol Trim13
Ensembl Gene ENSMUSG00000035235
Gene Nametripartite motif-containing 13
SynonymsLEU5, RNF77, Rfp2, 3110001L12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8461 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location61598247-61605946 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61605472 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 313 (Y313H)
Ref Sequence ENSEMBL: ENSMUSP00000045009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039562] [ENSMUST00000051184] [ENSMUST00000165015] [ENSMUST00000225582]
Predicted Effect probably benign
Transcript: ENSMUST00000039562
AA Change: Y313H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000045009
Gene: ENSMUSG00000035235
AA Change: Y313H

DomainStartEndE-ValueType
RING 10 57 1.31e-8 SMART
BBOX 89 131 5.55e-12 SMART
transmembrane domain 316 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051184
SMART Domains Protein: ENSMUSP00000055327
Gene: ENSMUSG00000046168

DomainStartEndE-ValueType
BTB 5 106 8.7e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165015
AA Change: Y313H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128509
Gene: ENSMUSG00000035235
AA Change: Y313H

DomainStartEndE-ValueType
RING 10 57 1.31e-8 SMART
BBOX 89 131 5.55e-12 SMART
transmembrane domain 316 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225582
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This gene is located on chromosome 13 within the minimal deletion region for B-cell chronic lymphocytic leukemia. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700067P10Rik G T 17: 48,090,329 E45* probably null Het
4921539E11Rik T C 4: 103,255,515 D132G probably benign Het
Abca16 T C 7: 120,436,695 F334L possibly damaging Het
Ache T C 5: 137,290,320 F96S probably damaging Het
Actg1 T C 11: 120,348,184 T27A unknown Het
Ankrd27 T C 7: 35,627,486 L752P probably damaging Het
Atp1a1 T A 3: 101,589,089 T417S probably benign Het
Atp6v0a1 T G 11: 101,044,574 L653R possibly damaging Het
Aurkb T C 11: 69,050,901 V293A probably damaging Het
C2cd5 A T 6: 143,035,076 D654E probably damaging Het
Cacna1s T C 1: 136,073,702 V297A possibly damaging Het
Catsperg2 T C 7: 29,705,319 D773G possibly damaging Het
Ccdc187 A G 2: 26,293,802 L62P probably damaging Het
Cdh2 A G 18: 16,650,465 V69A probably benign Het
D430041D05Rik A G 2: 104,167,935 V1156A possibly damaging Het
Defb37 G A 8: 18,986,370 H45Y unknown Het
Dgke T C 11: 89,048,993 M367V possibly damaging Het
Dnah1 T C 14: 31,305,958 K640R probably benign Het
Gm5478 A T 15: 101,646,217 L148Q probably damaging Het
Hhla1 A T 15: 65,923,874 S494R probably benign Het
Kcne4 G A 1: 78,817,716 S27N probably benign Het
Klhdc7b A T 15: 89,387,621 H244L probably damaging Het
Lrrc40 T C 3: 158,058,734 S429P possibly damaging Het
Map3k21 A T 8: 125,944,622 D883V probably benign Het
Med4 T C 14: 73,518,028 S259P unknown Het
Mrm3 T C 11: 76,244,332 I123T probably damaging Het
Mrpl1 T A 5: 96,213,787 V11D probably damaging Het
Myl1 G A 1: 66,944,835 P24L unknown Het
Necap2 T C 4: 141,070,220 K168R probably damaging Het
Nnt A G 13: 119,368,502 S559P unknown Het
Nox4 T C 7: 87,317,271 F197L probably damaging Het
Nup93 T C 8: 94,281,335 probably null Het
Nxph2 T C 2: 23,321,517 V10A unknown Het
Olfr1 T A 11: 73,395,156 I289F probably damaging Het
Olfr1085 G A 2: 86,657,546 T304I probably benign Het
Olfr251 T A 9: 38,378,481 V194D probably damaging Het
P2ry2 G T 7: 100,998,688 R137S possibly damaging Het
Plxnb3 T C X: 73,759,497 Y324H probably damaging Het
Pmpca G C 2: 26,395,034 E424Q possibly damaging Het
Ppme1 T C 7: 100,371,805 S7G probably benign Het
Rabep1 T A 11: 70,884,855 M85K possibly damaging Het
Ranbp2 T C 10: 58,476,394 Y979H probably damaging Het
Rapgef5 T C 12: 117,714,109 S360P probably benign Het
Rbm33 T A 5: 28,387,972 H623Q probably damaging Het
Rev1 G T 1: 38,083,787 T450K possibly damaging Het
Sec23ip T A 7: 128,772,202 L716Q probably benign Het
Sp2 T C 11: 96,955,913 T535A possibly damaging Het
Syne1 A G 10: 5,061,463 S61P probably benign Het
Tcf4 T C 18: 69,465,430 V72A probably benign Het
Tmem131 G A 1: 36,794,821 S1726F probably damaging Het
Ttn A G 2: 76,781,093 V17365A possibly damaging Het
Uap1l1 G A 2: 25,365,410 A69V probably benign Het
Upp2 A G 2: 58,780,056 D258G probably benign Het
Vmn1r44 A T 6: 89,893,719 H149L possibly damaging Het
Zbtb49 T C 5: 38,201,109 D600G probably benign Het
Zfp869 G T 8: 69,707,655 H89Q probably benign Het
Other mutations in Trim13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Trim13 APN 14 61605670 missense probably benign
IGL00811:Trim13 APN 14 61604857 splice site probably null
IGL01760:Trim13 APN 14 61605723 missense probably benign 0.06
IGL02411:Trim13 APN 14 61605149 missense probably damaging 1.00
IGL02625:Trim13 APN 14 61605550 missense probably benign 0.00
IGL02926:Trim13 APN 14 61605244 splice site probably null
IGL03231:Trim13 APN 14 61605545 missense probably benign 0.11
R0089:Trim13 UTSW 14 61604717 missense possibly damaging 0.95
R0811:Trim13 UTSW 14 61605700 missense probably benign
R0812:Trim13 UTSW 14 61605700 missense probably benign
R1515:Trim13 UTSW 14 61605659 missense probably benign 0.03
R1778:Trim13 UTSW 14 61605619 missense probably benign 0.13
R2018:Trim13 UTSW 14 61604886 nonsense probably null
R2019:Trim13 UTSW 14 61604886 nonsense probably null
R4865:Trim13 UTSW 14 61605517 missense probably benign
R5456:Trim13 UTSW 14 61605074 missense possibly damaging 0.91
R5860:Trim13 UTSW 14 61604739 missense probably damaging 0.96
R5921:Trim13 UTSW 14 61605089 missense probably benign 0.00
R7026:Trim13 UTSW 14 61605113 nonsense probably null
R7147:Trim13 UTSW 14 61604631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGAGGCTTTCAAAGATGTC -3'
(R):5'- CTGCCACATTGTTCAGTGCC -3'

Sequencing Primer
(F):5'- GAGGCTTTCAAAGATGTCTCAGAACC -3'
(R):5'- GAAAAACCCATCTGTCATCTGTTC -3'
Posted On2020-10-20