Incidental Mutation 'R8501:Agbl2'
ID655311
Institutional Source Beutler Lab
Gene Symbol Agbl2
Ensembl Gene ENSMUSG00000040812
Gene NameATP/GTP binding protein-like 2
SynonymsA430081C19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8501 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location90782727-90834437 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90797564 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 238 (G238R)
Ref Sequence ENSEMBL: ENSMUSP00000048647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037206] [ENSMUST00000037219] [ENSMUST00000051831] [ENSMUST00000111481] [ENSMUST00000136058] [ENSMUST00000170320]
Predicted Effect probably damaging
Transcript: ENSMUST00000037206
AA Change: G238R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047936
Gene: ENSMUSG00000040812
AA Change: G238R

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 375 541 1.8e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000037219
AA Change: G238R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048647
Gene: ENSMUSG00000040812
AA Change: G238R

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 5e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000051831
AA Change: G238R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051620
Gene: ENSMUSG00000040812
AA Change: G238R

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 565 1.6e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111481
AA Change: G238R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107106
Gene: ENSMUSG00000040812
AA Change: G238R

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 5e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000136058
AA Change: G238R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115632
Gene: ENSMUSG00000040812
AA Change: G238R

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 2.8e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170320
AA Change: G238R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129216
Gene: ENSMUSG00000040812
AA Change: G238R

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 558 1.8e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik C A 17: 33,067,064 A255S probably benign Het
5031439G07Rik C T 15: 84,960,523 V98M probably damaging Het
Atg2a T C 19: 6,254,390 S1146P probably damaging Het
Atg3 C A 16: 45,182,931 D207E probably damaging Het
Atp8b3 A G 10: 80,520,146 V1244A probably benign Het
Cacna1i T C 15: 80,382,046 probably null Het
Ccdc171 G T 4: 83,663,658 E675* probably null Het
Cep68 A T 11: 20,239,132 S627T unknown Het
Chrnd T C 1: 87,192,616 W165R probably damaging Het
Col6a2 G T 10: 76,603,557 A791D probably damaging Het
Dlg2 C A 7: 92,375,722 S598R probably damaging Het
Elfn2 G T 15: 78,674,300 Q16K probably benign Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gpr165 C A X: 96,714,017 D7E probably benign Het
Grm8 A T 6: 27,618,541 M434K probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Igf2 G C 7: 142,654,042 P106R probably damaging Het
Klf7 T C 1: 64,079,163 S92G probably benign Het
Mme T A 3: 63,326,735 M73K probably damaging Het
Musk G C 4: 58,367,502 K588N probably damaging Het
Naa30 C A 14: 49,172,896 H94N possibly damaging Het
Naip6 C T 13: 100,300,276 A580T possibly damaging Het
Nfya A G 17: 48,398,989 L52P unknown Het
Olfr126 A G 17: 37,850,865 Y91C probably damaging Het
Olfr346 A G 2: 36,688,797 N265S probably benign Het
Olfr65 T A 7: 103,906,611 H54Q Het
Otogl A T 10: 107,790,560 M1481K probably benign Het
P4ha3 A G 7: 100,313,355 D440G probably damaging Het
Pcdhb13 A T 18: 37,444,440 T624S probably damaging Het
Piezo2 A G 18: 63,045,540 Y1769H probably damaging Het
Plekha6 T A 1: 133,287,837 V913E probably benign Het
Rapgefl1 A G 11: 98,842,227 E211G possibly damaging Het
Rcc2 T C 4: 140,715,926 L305P probably damaging Het
Rgs3 G T 4: 62,602,956 V47F possibly damaging Het
Scly A G 1: 91,319,076 S370G probably damaging Het
Setmar T A 6: 108,075,861 D105E probably benign Het
Slc9a9 A G 9: 94,855,739 Y233C probably damaging Het
Sp140 A T 1: 85,641,740 N357I probably damaging Het
Trim30c G C 7: 104,387,470 T227R probably benign Het
Unc79 G A 12: 103,092,638 V1014I probably damaging Het
Vmn1r151 A T 7: 22,499,609 F24I probably damaging Het
Vmn2r78 T C 7: 86,920,886 V204A probably damaging Het
Vps13a T C 19: 16,682,120 D1681G probably benign Het
Vwa2 T C 19: 56,908,982 V573A probably benign Het
Wfdc2 A G 2: 164,563,359 D44G probably damaging Het
Zfp40 T A 17: 23,178,298 N75I probably damaging Het
Other mutations in Agbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Agbl2 APN 2 90801045 missense probably damaging 1.00
IGL00515:Agbl2 APN 2 90793960 missense possibly damaging 0.93
IGL01694:Agbl2 APN 2 90801074 missense probably damaging 1.00
IGL02064:Agbl2 APN 2 90784024 utr 5 prime probably benign
IGL02708:Agbl2 APN 2 90801342 missense probably benign 0.23
IGL02715:Agbl2 APN 2 90805868 missense probably damaging 0.99
IGL02717:Agbl2 APN 2 90805868 missense probably damaging 0.99
IGL02982:Agbl2 APN 2 90805815 missense probably damaging 1.00
IGL03039:Agbl2 APN 2 90801222 missense possibly damaging 0.93
IGL03339:Agbl2 APN 2 90797563 missense probably damaging 1.00
R0243:Agbl2 UTSW 2 90791481 missense possibly damaging 0.80
R0381:Agbl2 UTSW 2 90784098 missense probably damaging 1.00
R0441:Agbl2 UTSW 2 90797483 nonsense probably null
R0549:Agbl2 UTSW 2 90789843 splice site probably benign
R0665:Agbl2 UTSW 2 90801210 missense probably damaging 1.00
R1412:Agbl2 UTSW 2 90788954 missense probably benign
R1682:Agbl2 UTSW 2 90784090 missense probably benign 0.06
R1694:Agbl2 UTSW 2 90801320 missense probably damaging 1.00
R1733:Agbl2 UTSW 2 90810745 missense probably damaging 1.00
R1750:Agbl2 UTSW 2 90816376 utr 3 prime probably benign
R1916:Agbl2 UTSW 2 90815441 missense possibly damaging 0.73
R1940:Agbl2 UTSW 2 90811282 missense probably damaging 0.99
R3115:Agbl2 UTSW 2 90805901 missense possibly damaging 0.85
R3407:Agbl2 UTSW 2 90791618 missense probably damaging 1.00
R3710:Agbl2 UTSW 2 90805808 missense probably benign 0.00
R4227:Agbl2 UTSW 2 90801453 missense probably damaging 0.96
R4719:Agbl2 UTSW 2 90815389 missense probably benign 0.01
R4903:Agbl2 UTSW 2 90797473 missense possibly damaging 0.50
R5170:Agbl2 UTSW 2 90803197 missense probably benign 0.10
R5535:Agbl2 UTSW 2 90810006 missense probably benign 0.26
R5677:Agbl2 UTSW 2 90807978 missense possibly damaging 0.66
R6041:Agbl2 UTSW 2 90808027 missense probably benign 0.00
R6195:Agbl2 UTSW 2 90813313 missense probably benign 0.02
R6233:Agbl2 UTSW 2 90813313 missense probably benign 0.02
R6607:Agbl2 UTSW 2 90801326 missense probably damaging 0.99
R6752:Agbl2 UTSW 2 90803074 missense probably damaging 1.00
R7104:Agbl2 UTSW 2 90797547 missense probably damaging 1.00
R7261:Agbl2 UTSW 2 90788944 missense possibly damaging 0.94
R7555:Agbl2 UTSW 2 90791555 missense probably damaging 1.00
R7704:Agbl2 UTSW 2 90789005 missense probably benign 0.05
R7833:Agbl2 UTSW 2 90815433 missense probably benign 0.00
R7960:Agbl2 UTSW 2 90791631 missense probably benign 0.01
R8070:Agbl2 UTSW 2 90791565 missense probably benign 0.00
R8248:Agbl2 UTSW 2 90797564 missense probably damaging 1.00
R8249:Agbl2 UTSW 2 90797564 missense probably damaging 1.00
R8250:Agbl2 UTSW 2 90797564 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTCTGAGTGGAGCATTAGCC -3'
(R):5'- CGGATCCAACTTTTAAGTGATCTC -3'

Sequencing Primer
(F):5'- GGAGCATTAGCCTCATGGTATC -3'
(R):5'- CACCCATCTTTTGCAGACA -3'
Posted On2020-10-20